We narrowed to 3,367 results for: aaas
-
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Sec6
Plasmid#31118DepositorAvailable SinceSept. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup88-HindIII
Plasmid#87329PurposeTo express shRNA against human Nup88DepositorInsertshRNA against human Nup88
UseRNAiExpressionMammalianPromoterH1Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pADH118-17
Plasmid#91727PurposeNAT-marked C. albicans URA3-specific gRNA expression construct; part 2 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH137 CAS9 expression construct.DepositorInsertNAT 2of2, pSNR52, C. albicans URA3-specific gRNA, LEU2 2of2
Available SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced MUT
Plasmid#242750PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-miR.FF4
Plasmid#235256PurposeNon-intronic (U6-driven) expression of miR-FF4 (FF4 hairpin)DepositorInsertFF4 hairpin
UseSynthetic BiologyExpressionMammalianPromoterU6Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
shRNA-Ratio-NegCon
Plasmid#183554PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio negative control (Luciferase), Fig S2)DepositorInsertLuciferase shRNA
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_10bp 5'SS_No BP or pBP_pUC18
Plasmid#100989PurposeRp51a with a tGGTAtGTta->AGGTAAGTAT 5'SS mutant with potential to form 10bps with the U1 snRNA. Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationtGGTAtGTta->AGGTAAGTAT 5'SS mutant, TACTA…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rp51a_SUS1 5'ss_No_BP_pBP-pUC18
Plasmid#100990PurposeContains model Rp51a with a GGTAtGT->tGTAtGa 5'SS mutant (SUS1 5'SS sequence). Also contains TACTAAC->GTTAGTG BP mutataion and a TACAAAC->GTTTGTG pseudo BP mutationDepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationGGTAtGT->tGTAtGa 5'SS mutant, TACTAAC->…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN2-exon7-ESE1
Plasmid#126042PurposeIn-vitro-transcription of SMN2-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN2 exon7 ESE1
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
MLSE-shTAF12.376
Plasmid#105578Purposeretrovirally express TAF12 shRNA with GFP markerDepositorInsertTAF12 shRNA #376
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTAF4.2818
Plasmid#105563Purposeretrovirally express TAF4 shRNA with puro resistance and GFP markerDepositorInsertTAF4 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only