We narrowed to 3,402 results for: aaas
-
Plasmid#113741PurposeGateway entry vector containing attL5 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1R5
Plasmid#113737PurposeGateway entry vector containing attL1 and attR5 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1S_AmpR
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-phaZ
Plasmid#169874PurposeSingle guide RNA plasmid for Cas9 targeting phaZ in P. putidaDepositorInsertsgRNA towards phaZ in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 2
Plasmid#70657PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M2S_AmpR
Plasmid#119154PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with two mismatches in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with two mismatches in the seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-WDR5 shRNA 2
Plasmid#59975PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 EB1 shRNA #1
Plasmid#37928DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Sec6
Plasmid#31118DepositorAvailable SinceSept. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup88-HindIII
Plasmid#87329PurposeTo express shRNA against human Nup88DepositorInsertshRNA against human Nup88
UseRNAiExpressionMammalianPromoterH1Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pADH118-17
Plasmid#91727PurposeNAT-marked C. albicans URA3-specific gRNA expression construct; part 2 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH137 CAS9 expression construct.DepositorInsertNAT 2of2, pSNR52, C. albicans URA3-specific gRNA, LEU2 2of2
Available SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced MUT
Plasmid#242750PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-miR.FF4
Plasmid#235256PurposeNon-intronic (U6-driven) expression of miR-FF4 (FF4 hairpin)DepositorInsertFF4 hairpin
UseSynthetic BiologyExpressionMammalianPromoterU6Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 1
Plasmid#193598PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 1 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only