We narrowed to 15,905 results for: grna
-
Plasmid#183138PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 3 gRNA targeting D.suzukii bTub,Hr5Ie1-eGFP tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-neo-sgTAF12(human)#4.4
Plasmid#105590Purposelentivirally express gRNA targeting human TAF12 HFD with GFP marker and neo resistanceDepositorPublicationInsertgRNA targeting human TAF12 HFD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTC441
Plasmid#91218Purposeprotoplast vector for targeted deletion of MLO gene in barley (PvUbi1 promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC437
Plasmid#91219Purposeprotoplast vector for targeted deletion of MLO gene in barley (CmYLCV promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC363
Plasmid#91211Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtU6 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC303
Plasmid#91210Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRDA_550
Plasmid#203398PurposeAll-in-one lentiviral expression of gRNA and EnAsCas12aDepositorInsertEnhanced Acidaminococcus Cas12a
UseCRISPR and LentiviralPromoterEF1aAvailable sinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CRISPR_HLA_class_I_2
Plasmid#164987PurposeExpression of gRNA targeting multiple HLA-A, HLA-B, and HLA-C genesDepositorInsertgRNA against HLA class I
UseCRISPRExpressionMammalianAvailable sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-Actin
Plasmid#119870PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse Beta ActinDepositorInsertbeta Actin (Actb Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP
Plasmid#62348PurposeAn empty optimized gRNA expression vectorDepositorInsertnone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ141-ZmUBI-RZ-Cas12j2
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1067B
Plasmid#200252PurposepBac-U6-gRNA(doublesex)-3xp3-tdTomatoDepositorPublicationInsert4 gRNAs targeting Doublesex
ExpressionInsectAvailable sinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSI-359
Plasmid#131131PurposegRNA expression vector for A-to-G base editing reporterDepositorInsertA-to-G reporter activation gRNA
UseCRISPRExpressionMammalianPromoterHuman U6 promoterAvailable sinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgPTEN
Plasmid#202759PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting PTENDepositorInsertgRNA targeting PTEN
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-1
Plasmid#164858PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-1
ExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-NT
Plasmid#164857PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-NT
ExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_84
Plasmid#60076PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available sinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_83
Plasmid#60075PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available sinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_82
Plasmid#60074PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available sinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only