We narrowed to 15,613 results for: grna
-
Plasmid#91211Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtU6 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC303
Plasmid#91210Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_class_I_2
Plasmid#164987PurposeExpression of gRNA targeting multiple HLA-A, HLA-B, and HLA-C genesDepositorInsertgRNA against HLA class I
UseCRISPRExpressionMammalianAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP
Plasmid#62348PurposeAn empty optimized gRNA expression vectorDepositorInsertnone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUBI-RZ-Cas12j2
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1067B
Plasmid#200252PurposepBac-U6-gRNA(doublesex)-3xp3-tdTomatoDepositorInsert4 gRNAs targeting Doublesex
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS316-RGR-GFP
Plasmid#51056PurposeExpress self-cleaving-ribozyme-flanked sgRNA cassette (RGR) targeting GFP for CRISPR systems in yeast driven by ADH1 promoter. RGR has a HH ribozyme at its 5', and an HDV ribozyme at its 3'.DepositorInsertRGR-GFP
UseCRISPRExpressionBacterial and YeastPromoterYeast ADH1 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSI-359
Plasmid#131131PurposegRNA expression vector for A-to-G base editing reporterDepositorInsertA-to-G reporter activation gRNA
UseCRISPRExpressionMammalianPromoterHuman U6 promoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC-tRNAGln-BbsI-sU6-Kan
Plasmid#213016PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (tRNA-Gln and synthetic U6)DepositorInserttRNAGln promoter, sU6 promoter, gRNA scaffolds
PromotertRNAGln promoterAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-1
Plasmid#164858PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-1
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-NT
Plasmid#164857PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-NT
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_84
Plasmid#60076PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_83
Plasmid#60075PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_82
Plasmid#60074PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_80
Plasmid#60072PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC74
Plasmid#62342PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only