-
Plasmid#29053PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-GenRep
Plasmid#214674PurposeMAPT Exon 10 reporter, with Exon 10 and 100bp flanking intronic regions replaced with a BamHI/EcoRI cloning site for testing different exonsDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9 and Exon 11, with a BamHI EcoRI c…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 Stop
Plasmid#84895PurposeDONOR vector for Gateway cloning of TAF15DepositorInsertTAF15 (TAF15 Human)
UseGateway donorTagsExpressionMutationPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 No Stop
Plasmid#84888PurposeDONOR vector for Gateway cloning of EWSR1 No StopDepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationno stopPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pK27Sumo_His-SUMO-nsp10-nsp16 fusion (SARS-CoV-2)
Plasmid#169191PurposeTo express nsp10-nsp16 fusion protein in E. coliDepositorInsert14His-SUMO-nsp10-GSGSGS-nsp16 (ORF1ab Synthetic, SARS-CoV-2)
UseTags14His-SUMO and Fusion protein of SARS-CoV-2 nsp10…ExpressionBacterialMutationCodon optimised for E. coliPromoterT5Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 Stop
Plasmid#84887PurposeDONOR vector for Gateway cloning of EWSR1DepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_33
Plasmid#60275PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertGLIS3 enhancer (GLIS3 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_13
Plasmid#60298PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertEDN3 enhancer (EDN3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianMutationPromoterMoloney murine leukemia virus long terminal repeatAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 No Stop
Plasmid#84896PurposeDONOR vector for Gateway cloning of TAF15 No StopDepositorInsertTAF15 (TAF15 Human)
UseGateway donorTagsExpressionMutationNo StopPromoternoneAvailable sinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-CBP core
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_20
Plasmid#60303PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCDKN1C enhancer (CDKN1C Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_15
Plasmid#60322PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS PHLDA1) (PHLDA1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_33
Plasmid#60312PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertGLIS3 enhancer (GLIS3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del37/GAG)
Plasmid#166129PurposeExpression of human talin-1 head (aa1-405) in E. coli. Contains 37 amino acid deletion in F1-loop, replaced with Gly-Ala-Gly. N-terminal His6, Xpress-epitopeDLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(del37/GAG) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405, with 37 aa deletion in the F1-loop which…PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
UseTagsmEos2ExpressionMammalianMutationPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OKM
Plasmid#136554PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Klf4, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only