We narrowed to 2,374 results for: Clu
-
Plasmid#136555PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
t1-405(151-154AAAA)
Plasmid#166131PurposeExpression of human talin-1 head (aa1-405) in E. coli. Four substitutions in the F1-loop (aa151-154 all mutated to Al). N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(151-154AAAA) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405 only. Contains 4 amino acid substitutions…PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a No Stop
Plasmid#84894PurposeDONOR vector for Gateway cloning of EWSR1 g1750a No StopDepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationg1750a No StopPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a Stop
Plasmid#84893PurposeDONOR vector for Gateway cloning of EWSR1 g1750a StopDepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationg1750aPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 c1655t Stop
Plasmid#84891PurposeDONOR vector for Gateway cloning of EWSR1 c1655t StopDepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationc1655tPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_27
Plasmid#60307PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertC16orf80 enhancer (CFAP20 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_28
Plasmid#60308PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCRY2 enhancer (CRY2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_32
Plasmid#60311PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertDGKB enhancer (DGKB Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_36
Plasmid#60314PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertDNMT3A enhancer (DNMT3A Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_37
Plasmid#60315PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertARHGAP26 enhancer (ARHGAP26 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_38
Plasmid#60316PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertACSL1 enhancer (ACSL1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_39
Plasmid#60317PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertPCSK1 enhancer (PCSK1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_6
Plasmid#60255PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertGRM4 enhancer (GRM4 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_8
Plasmid#60257PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertKIRREL3 enhancer (KIRREL3 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_11
Plasmid#60260PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertCDKAL1 enhancer (CDKAL1 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_13
Plasmid#60261PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertEDN3 enhancer (EDN3 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only