We narrowed to 15,613 results for: grna
-
Plasmid#135745PurposeEncodes gRNA for 3' target of human MLLT10_iso1DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PX458_HOMEZ_1
Plasmid#86352PurposeEncodes gRNA for 3' target of human HOMEZDepositorInsertgRNA against HOMEZ (HOMEZ Human)
UseCRISPRAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HOMEZ_2
Plasmid#86353PurposeEncodes gRNA for 3' target of human HOMEZDepositorInsertgRNA against HOMEZ (HOMEZ Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP2
Plasmid#79874PurposeBacillus subtilis sgRNA expression vector; integrates into amyEDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAH237
Plasmid#121146PurposeExpression of both nmt41p-cas9 and rrk1p-gRNA (LEU2 marker) for CRISPR genome editing in fission yeastDepositorInsertsgRNA cassette
humanized Streptococcus pyogenes Cas9
UseCRISPRTagsFlagExpressionYeastPromoterS.pombe rrk1 and nmt41Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF331_1
Plasmid#135739PurposeEncodes gRNA for 3' target of human ZNF331DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV ORANGE Gria1-HaloTag KI
Plasmid#139655PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorInsertgRNA and HaloTag donor
UseAAVExpressionMammalianPromoterU6Available SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBUN501
Plasmid#50582PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Bar resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …PromoterAtU6-26p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 hBAX
Plasmid#129580PurposeCRISPR deletion of human BAXDepositorAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA(tyr)
Plasmid#64250Purposeexpresses sgRNA(tyr) under U6a promoterDepositorInsertU6a:sgRNA (tyr)
UseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAN1 gRNA HIS
Plasmid#182521PurposeExpression vector for gRNA directed against CAN1 ORF.DepositorInsertCAN1 gRNA (CAN1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOC1 Halo-Actb KI
Plasmid#183426PurposeCreON knock-in for Halo-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and Halo donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE834
Plasmid#231168PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-NT-1mer-gRNA
Plasmid#227500Purposenon-targeting control guideDepositorInsertNon-targeting gRNA
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-1
Plasmid#164865PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-1
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only