We narrowed to 9,067 results for: sgRNA
-
Plasmid#179456PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP1187
Plasmid#119256Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
p104Tol2-tp1:Cas9-t2A-GFP, 4xU6:sgRNA
Plasmid#227773PurposeExpression of tp1 (Notch) dependent Cas9-GFP and U6-driven 4 sgRNAs in zebrafishDepositorInsertsCas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterU6 and tp1Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M2S_AmpR
Plasmid#119154PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with two mismatches in the seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with two mismatches in the seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTAG1
Plasmid#176863PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA_1
UseCRISPRMutationWTAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAG2E
Plasmid#176865PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA_2E
UseCRISPRMutationWTAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC545
Plasmid#62313PurposesgRNA with 1x MS2 for yeast cellsDepositorInsertsgRNA + 1x MS2 binding module
ExpressionYeastPromoterSNR52Available sinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBHM2650
Plasmid#229992PurposeCarries AID* tag, empty sgRNA, and HYGR markerDepositorInsertAID* - empty sgRNA - HYGR
Tags2xFLAGExpressionBacterial and YeastAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2652
Plasmid#229994PurposeCarries AID* tag, empty sgRNA, and amdS markerDepositorInsertAID* - empty sgRNA - amdS
Tags2xFLAGExpressionBacterial and YeastAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAF-HdrB3
Plasmid#184908Purposecarrying CRISPR/Cas9 system for genome editing in Acidithiobacillus ferriduransDepositorInsertCas9-sgRNA-homology arms
UseCRISPR; Broad-host-rangeExpressionBacterialAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUB-Cas9-@GL1
Plasmid#86779PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9DepositorInsertsgRNA against GLABROUS1
UseSynthetic BiologyExpressionPlantPromoterArabidopsis U6-26 promoterAvailable sinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available sinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TC9
Plasmid#202088Purposeentry vector for gateway recombination of TevCas9 and sgRNA into a destination cassette in pCitro-destDepositorInsertTevCas9 + sgRNA cassette
UseCRISPRAvailable sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
(pRZ219) AAV: U6-gRNA-EF1a-mScarlet
Plasmid#254585PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available sinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LLP1014
Plasmid#239936PurposeHsp18.2 (heat inducible) promoter driving the expression of sgRNA-BDepositorInsertHsp18.2::sgRNA-B
UseSynthetic BiologyExpressionPlantMutationN/AAvailable sinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only