-
Plasmid#31138DepositorInsertADAM7 (ADAM7 Human)
UseTagsFLAGExpressionMammalianMutationHistidine 243 changed to TyrosinePromoterAvailable sinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-51kb-DSF
Plasmid#227496Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 51kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-USF
Plasmid#227467Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-PGK-FLPo-IRES-Puro
Plasmid#205989PurposeExpresses Flp recombinase and puromycin resistanceDepositorInsertsUseTagsExpressionMammalianMutationPromoterPGK promoterAvailable sinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
ClhN-P1K-3VSV-Atg8(L55W T56A V61W R65A)-MET15
Plasmid#207054PurposeExpression of 3VSV-Atg8 point mutant. Uses auxotrophic marker MET15(Saccharomyces cerevisiae).DepositorInsertATG8
UseTags3xVSVExpressionYeastMutationL55W T56A V61W R65APromoterAvailable sinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDA2ScIfm
Plasmid#193786PurposeExpresses frame-shifted CI under the control of PLTATAA synthetic promoter, carries a synthetic fragment with additional restriction sites, ColE1 origin of replication, Ampicillin selectionDepositorInsertFrame-shifted CI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPLTATAA synthetic promoter carrying binding sites…Available sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKIF1C_P176L-mCherry-FRB
Plasmid#185983PurposeMammalian expression of human KIF1C with P176L mutation and mCherry and FRB tags.DepositorInsertKIF1C (KIF1C Human)
UseTagsmCherry and FRBExpressionMammalianMutationP176L - mutation causing HSP (SPG58)PromoterAvailable sinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C_R169W-GFP
Plasmid#185979PurposeBaculovirus expression of human KIF1C with R169W mutation and 6xHis and GFP tags.DepositorInsertKIF1C (KIF1C Human)
UseTags6xHis and eGFPExpressionInsectMutationR169W - mutation causing HSP (SPG58)PromoterAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C_P176L-GFP
Plasmid#185978PurposeBaculovirus expression of human KIF1C with P176L mutation and 6xHis and GFP tags.DepositorInsertKIF1C (KIF1C Human)
UseTags6xHis and eGFPExpressionInsectMutationP176L - mutation causing HSP (SPG58)PromoterAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-URH49 MUT
Plasmid#110126PurposeExpresses Flag-tagged human URH49 (DDX39A) with 4 mutations that impact circRNA nuclear export activityDepositorInsertURH49 (DDX39A Human)
UseTagsFlagExpressionInsectMutation4 amino acid mutations (RSFS motif changed to KSL…PromoterMetallothionein Promoter (pMT)Available sinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E MUT
Plasmid#110122PurposeExpresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activityDepositorInsertHel25E (Hel25E Fly)
UseTagsFlagExpressionInsectMutation4 mutations (KKLN motif changed to RSFS)PromoterMetallothionein Promoter (pMT)Available sinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-001428(753)-VC
Plasmid#123256PurposeMammalian expression plasmid for Env from the 001428 HIV-1 isolate; C-terminal truncation fused to the C-terminal half of split fluorescent Venus (VC)DepositorInsertHIV-1 (001428) Env
UseTagsCD5 leader peptide and VC (Venus residues D155–K2…ExpressionMammalianMutationCodon-optimized synthetic gene; C-terminal Env re…PromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-ADAM29 (S112F)
Plasmid#31145DepositorInsertADAM29 (ADAM29 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationSerine 112 changed to PheylalninePromoterAvailable sinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ADAM7 (S703N)
Plasmid#31141DepositorInsertADAM7 (ADAM7 Human)
UseTagsFLAGExpressionMammalianMutationS703NPromoterAvailable sinceJuly 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only