We narrowed to 11,728 results for: 110
-
Plasmid#110728PurposeMammalian Expression of p16INK4A IRES zsGreenDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pRSF-T20S
Plasmid#110805Purposeexpresses Thermoplasma acidophilium 20S proteasome in E. ColiDepositorInsertsPsmB
PsmA
Tagstev-HisExpressionBacterialMutationN2D and Q2EPromoterT7 and T7 promoterAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEXC3H
Plasmid#110080PurposeAnalogous to pMINTC3H, but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTags3C cleavage site - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1D V5-His-TOPO-KGA.wt
Plasmid#110332PurposeMammalian expression of glutaminase isoform KGA (wild type) with V5 and 6xHis tagsDepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MP28444 – pFUSE2ss-aRD114_CHIg-mIgG2A
Plasmid#110555PurposepFUSE backbone with an IL2 signal sequence, expressing the variable heavy chain of anti-RD114 binder fused to murine IgG2A constant heavy chain.DepositorInsertAnti-RD114 heavy chain
TagsmIgG2AExpressionBacterial and MammalianPromoterEF-1 alpha core promoterAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NXF1_TAP-C
Plasmid#110038PurposeProtein expression and purification of NXF1_TAP-CDepositorInsertNXF1_TAP-C (NXF1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX458_Ruby
Plasmid#110164PurposeCas9 from S. pyogenes with Ruby2, and cloning backbone for sgRNADepositorInserthSpCas9
UseCRISPRTags3xFLAG and Ruby2ExpressionMammalianAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
MP28445 – pFUSE2ss-aRD114_CLIg-mIgK
Plasmid#110556PurposepFUSE backbone with an IL2 signal sequence, expressing the variable light chain of anti-RD114 binder fused to murine Kappa constant light chain.DepositorInsertanit-RD114 light chain
TagsmKappaExpressionBacterial and MammalianPromoterEF-1 alpha core promoterAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-OGDH_wobble
Plasmid#110938PurposeOGDH ORF containing silent wobble mutations insensitive to corresponding shRNAsDepositorInsertOGDH wobble cDNA (OGDH Human)
UseLentiviralMutation15 silent wobble mutations corresponding to three…PromoterSV40Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE3G-FNLS-PGK-Puro
Plasmid#110847PurposeLentiviral vector for dox-inducible expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterTRE3GAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
hCCR5-mTFP1
Plasmid#110193PurposeEncodes for human CCR5 coding sequence tagged with the mTFP1 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DYNLL1_Dynein-light
Plasmid#110006PurposeProtein expression and purification of DYNLL1_Dynein-lightDepositorInsertDYNLL1_Dynein-light (DYNLL1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PTEN
Plasmid#110181PurposeExpression of PTEN tagged with EGFPDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFR D770-N771 insNPG
Plasmid#11016PurposeRetroviral construct for expressing human EGFR with D770-N771 insNPG mutation in human cellsDepositorInsertEGFR D770-N771 insNPG (EGFR Human)
UseRetroviralExpressionMammalianMutationD770-N771 insNPGAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-eEF2K
Plasmid#110160PurposeExpression of human eEF2K in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Paf1
Plasmid#11059DepositorInsertPaf1 (PAF1 Human)
ExpressionMammalianAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_GNAI3_G-alpha
Plasmid#110014PurposeProtein expression and purification of GNAI3_G-alphaDepositorInsertGNAI3_G-alpha (GNAI3 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFR (del3) L747-E749del, A750P
Plasmid#11015PurposeRetroviral construct for expressing human EGFR with L747-E749 deletion and A750P mutation in human cellsDepositorInsertEGFR (del3) (EGFR Human)
UseRetroviralExpressionMammalianMutationL747-E749 deleted, A750PAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only