We narrowed to 6,725 results for: SIM;
-
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ABE8e-Cas9NG
Plasmid#203328PurposePlasmid for bacterial purification of codon optimized ABE8e-Cas9NGDepositorInsertABE8e-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialMutationPromoterAvailable sinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
hSyn-GtACR2-ChRmine-tandem-eYFP
Plasmid#192580PurposeAAV-vector for bidirectional optogenetic manipulation of neuronsDepositorInsertsomBiPOLES
UseAAVTagsEYFP- soma-targeting motif from Kv2.1 channelExpressionMammalianMutationPromoterhuman synapsinAvailable sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-Octo_VirD2_NLS-Cas9-6xHis
Plasmid#232296PurposeExpresses Cas9 protein fused with octopine-type VirD2-originating NLSDepositorInsertOcto_VirD2_NLS-Cas9-6xHis
UseCRISPRTags6xHis and Octopine-type VirD2-derived NLSExpressionBacterialMutationPromoterT7Available sinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
evoFERNY-Cas9NG
Plasmid#203329PurposePlasmid for bacterial purification of codon optimized evoFERNY-Cas9NGDepositorInsertevoFERNY-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialMutationPromoterAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-NTID194-GSQ-PMLiva3MAS-P2A-BLAST
Plasmid#208039PurposeEnables constitutive expression of N-terminal Split-TurboID-fused PML (isoform IVa; 3MAS mutant; K>R sumoylation sites, mutated SIM); selection with blasticidinDepositorInsertPML (isoform IVa; 3MAS) (PML Human)
UseLentiviralTagsFLAG, N-terminal Split-TurboIDExpressionMutation3MAS mutant: K65R, K160R and K490R; mutated SIMPromoterEFSAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN2 BSD
Plasmid#92246PurposeTALEN targeting downstream of HTT gene (ELD) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN1 ZEO. TALEN: NN, HD, NN, NN, HD, NG, NN, NI, NN, NN, HD, NI, NN, HD, NI, NNDepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCAGAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN1 ZEO
Plasmid#92245PurposeTALEN targeting downstream of HTT gene (KKR) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN2 BSD. TALEN: HD, NI, NN, HD, NG, NG, HD, HD, NG, HD, NI, NN, HD, HD, NN, HDDepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCAGAvailable sinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHLsec-dasTMPRSS2
Plasmid#207850PurposeExpresses directed activation strategy TMPRSS2 in mammalian cells, such as HEK293F- or CHO-cellsDepositorInserttransmembrane serine protease 2 (TMPRSS2 Human)
UseTagsAviTag, 8xHIS tagExpressionMammalianMutationdeleted amino acid 1-108, S251D R252D Q253D S254D…PromoterCAGAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCROPseq-VEX-optimized-scaffold
Plasmid#203321PurposeModified CROPseq vector for efficient CRISPR screens in hematopoiesisDepositorInsertsgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJOP-HTT-HR65Q
Plasmid#92249PurposeHTT donor DNA with 65Q for homologous recombination-mediated gene modificationDepositorInsertHTT donor DNA (HTT Human)
UsePrecisionx hr targeting vectorTagsExpressionMutationBarcode of wobble bases to prevent TALEN cleaving…PromoterAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOP-HTT-HR81Q
Plasmid#92250PurposeHTT donor DNA with 81Q for homologous recombination-mediated gene modificationDepositorInsertHTT donor DNA (HTT Human)
UsePrecisionx hr targeting vectorTagsExpressionMutationBarcode of wobble bases to prevent TALEN cleaving…PromoterAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOP-HTT-HR30Q
Plasmid#92247PurposeHTT donor DNA with 30Q for homologous recombination-mediated gene modificationDepositorInsertHTT donor DNA (HTT Human)
UsePrecisionx hr targeting vectorTagsExpressionMutationBarcode of wobble bases to prevent TALEN cleaving…PromoterAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOP-HTT-HR45Q
Plasmid#92248PurposeHTT donor DNA with 45Q for homologous recombination-mediated gene modificationDepositorInsertHTT donor DNA (HTT Human)
UsePrecisionx hr targeting vectorTagsExpressionMutationBarcode of wobble bases to prevent TALEN cleaving…PromoterAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-a
Plasmid#87201PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting exon 1 of HTTDepositorInsertHTT (HTT Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-b
Plasmid#87200PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting 5' UTR of HTTDepositorInsertHTT (HTT Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
LIC4B-His-TEV-TAK1-TAB1
Plasmid#154874PurposeInsect cell optimized TAK1-TAB1 construct used to solve structure and deposit PDB ID: 4O91DepositorInsertTAK1-TAB1 (TAB1 Human)
UseTagsLIC TEV HisExpressionInsectMutationCodon optimizedPromoterpolyhedrinAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19_extendedTTE1564
Plasmid#60999PurposeT7-transcription template for Tte mRNA used in SiM-KARTSDepositorInsertTTE1564 transcript
UseUnspecifiedTagsExpressionMutationPromoterT7Available sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorInsertSPRTN (SPRTN Human)
UseTagsExpressionMammalianMutationP296L (see depositor comments below)PromoterAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only