We narrowed to 4,521 results for: GCA;
-
-
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
NDUFAB1 C4.3 gRNA
Plasmid#90793Purpose3rd generation lentiviral gRNA plasmid targeting human NDUFAB1DepositorAvailable SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
RPS6KL1 gRNA (BRDN0001145154)
Plasmid#77952Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SBK3 gRNA (BRDN0001146759)
Plasmid#75899Purpose3rd generation lentiviral gRNA plasmid targeting human SBK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TNIK gRNA (BRDN0001146101)
Plasmid#75850Purpose3rd generation lentiviral gRNA plasmid targeting human TNIKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK1 gRNA (BRDN0001148208)
Plasmid#75514Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgGLDC_1
Plasmid#72886PurposeCRISPR-Cas9 induced gene disruptionDepositorInsertsgGLDC
UseLentiviralPromoterCMVAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20_mStrawberry_Atg4BC74A
Plasmid#161735PurposeDoxycycline-inducible expression of Atg4B(C74A) fused with mStrawberry to inhibit autophagyDepositorInsertAtg4B(C74A) (Atg4b Mouse) (Atg4b Mouse)
UseLentiviral; Destinatioin vector for gateway cloni…TagsmStrawberryExpressionMammalianMutation220-222 TGC (Cys) is changed to GCA (Ala)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_Hyg_mTurquoise2_Atg4BC74A
Plasmid#161733PurposeDoxycycline-inducible expression of Atg4B(C74A) fused with mTurquoise2 to inhibit autophagyDepositorInsertAtg4B(C74A) (Atg4b Mouse) (Atg4b Mouse)
UseLentiviral; Destinatioin vector for gateway cloni…TagsmTurquoise2ExpressionMammalianMutation220-222 TGC (Cys) is changed to GCA (Ala)Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-5xE-box
Plasmid#206841PurposeThe plasmid contains a 312 bp DNA fragment that contained 5 canonical E-boxes (GCCACGTGCA) spaced by 50 nucleotides and cloned into pGL4.23[luc2/minP] (XhoI/HindIII).DepositorInsert5x E-box ((GCCACGTGCA)
UseLuciferaseAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001144754)
Plasmid#75602Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
TagsHAMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only