We narrowed to 1,704 results for: cag promoter
-
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0428 huDisCas7-11-R1045-GGGS-R1122-U6-pro-Gluc
Plasmid#186985PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, Gluc crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCrx-DsRed
Plasmid#13765DepositorAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-Tn7sg
Plasmid#248694PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNADepositorInsertTn7sg
ExpressionBacterialPromoterBG35Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pRSETB
Plasmid#55775PurposeGenetically encoded caged Ca2+DepositorInsertPACR
Tags6xHis and msEGFPExpressionBacterialPromoterT7 promoterAvailable SinceJuly 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-mCherry-CAAX
Plasmid#218189PurposeTo over express mCherry-CAAX under gfaABC1D promoter in astrocytesDepositorInsertmCherry-CAAX
UseAAVExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCX-H2B-KikGR
Plasmid#98649PurposeExpresses a nuclear-localized photoconvertible green-to-red fluorescent proteinDepositorInsertKikGR
TagsH2BExpressionMammalianPromoterCMV-IE enhancer chick beta actin promoterAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY_gRNA_hPAX7-Pro_C3
Plasmid#160454PurposesgRNA targeting human PAX7 promoterDepositorInsertgRNA_hPAX7-Promoter_C3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
phU6 ST
Plasmid#188712PurposesgRNA plasmid encoding hU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 ST
Plasmid#188713PurposesgRNA plasmid encoding mU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 ST
Plasmid#188715PurposesgRNA plasmid encoding hH1 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only