We narrowed to 5,097 results for: puc
-
Plasmid#111616PurposeFluorescence-based gauging of the level of the nucleotide secondary messenger cyclic di-GMP in Pseudomonas aeruginosa and related species.DepositorInsertPcdrA-RBSII-gfp(Mut3)-T0-T1
ExpressionBacterialAvailable SinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAcCas12nHS_ABE_D3_empty
Plasmid#203809PurposePlasmid containing a CMV-driven NLS-dAcCas12n(D240)-ABE-Design3-NLS cassette and a U6-driven sgRNA_V6 cassette(containing BsaI sites for spacer insertion).DepositorInsertABE_D3
UseCRISPRPromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-dsRed-shscramble
Plasmid#71384PurposeExpresses dsRed and scramble shRNA under the control of the CMV promoter in eukaryotic cellsDepositorInsertCMV promoter-dsRed-mir30-shscramble
UseLentiviral and RNAiExpressionMammalianPromoterCMV enhancer/promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMO746
Plasmid#117480Purposeupp in an artificial operon with npt from pMO9071 and AmpR-pUC ori from pCR4/TOPO, Pnpt-npt-upp;, KanRDepositorInserturacil phosphoribosyltransferase
ExpressionBacterialAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Bxb1_miRFP703
Plasmid#183759PurposeBxb1-specific donor plasmid for intergrating a transcription unit for expression of membrane-localised miRFP703DepositorInsertmiRFP703
TagsLck lipidation signalExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-GFP-shRNA-scramble
Plasmid#182503PurposeExpresses scramble shRNA for control expts. Flexed cassette driven by pan neuronal gene promoterDepositorInsertpan neuronal promoter driving flexed GFP-shRNA scramble from mir 30 cassette
UseAAV, Cre/Lox, and RNAiExpressionMammalianPromoterhSyn promoterAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-dsRed-shvgat
Plasmid#71385PurposeExpresses dsRed and shRNA against vgat under the control of the CMV promoter in eukaryotic cellsDepositorInsertCMV promoter-dsRed-mir30-shvgat
UseLentiviral and RNAiExpressionMammalianPromoterCMV enhancer/promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-ASAP2f
Plasmid#183757PurposeBxb1-specific donor plasmid for intergrating a transcription unit for expression of ASAP2f voltage reporterDepositorInsertASAP2f
ExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-iCre-2A-venus
Plasmid#182499PurposeExpresses iCre-venus. The promoter is a fragment of the hdc gene promoter that gives pan neuronal expressionDepositorInsertiCre-2A-Venus
UseAAV and Cre/LoxExpressionMammalianPromoterfragment of histidine decarboxylase gene promoter…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-rev-g2-2A-Venus
Plasmid#71410PurposeThis plasmid is pAAV-panpromoter-flex-rev-gamma2F77-2A-Venus. Confers zolpidem sensitivity on zolpidem-insensitive neurons.DepositorInsertsUseAAV and Cre/LoxExpressionMammalianPromotermouse hdc gene promoter, works as a pan neuronal …Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGRF-GIF
Plasmid#243677PurposeExpresses a chimeric protein composed of the wheat GROWTH-REGULATING-FACTOR and its wheat cofactor GRF-INTERACTING-FACTOR1 in plants via the CmYLCV 9.11 promoter and an Arabidopsis HSP terminatorDepositorInsertChimeric protein composed of GROWTH-REGULATING-FACTOR and its cofactor GRF-INTERACTING-FACTOR1 from wheat
ExpressionPlantAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTA1cI-T3
Plasmid#193789PurposeExpresses truncated version of lambda CI named T3 under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertTruncated version of Lambda CI, named T3, where the first two codons are deleted
UseSynthetic BiologyExpressionBacterialPromoterPLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
KG#797
Plasmid#110916PurposeExpresses the active zone - enriched protein Sentryn-GFP in a subset of cholinergic ventral nerve cord motor neuronsDepositorInsertsunc-129 promoter
STRN-1 (Sentryn)-GFP
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
TagsGFP (contains 3 artificial introns)ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#920
Plasmid#110937PurposeExpresses INS-22-Emerald in the cholinergic motor neuron DA9 for imaging Dense Core Vesicles in a single neuron in a living animalDepositorInsertsmig-13 promoter
INS-22-Emerald
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L-_lox
Plasmid#129756PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-A39T
Plasmid#129752PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L
Plasmid#129753PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG#493
Plasmid#110932PurposeExpresses proteins in C. elegans cholinergic neurons in head, ventral nerve cord, and tailDepositorInsertsunc-17 promoter
unc-54 3' control region
ExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#94
Plasmid#110931PurposeExpresses proteins in C. elegans cholinergic neurons in head, ventral nerve cord, and tailDepositorInsertsunc-17 promoter
unc-54 3' control region
ExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only