We narrowed to 4,490 results for: Gca
-
Plasmid#111822PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 294-314
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s-T78H
Plasmid#100021PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference LSSmOrange nested within the reporting superfolder cpGFP-T78HDepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
PLK1 gRNA (BRDN0001144995)
Plasmid#76459Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MELK gRNA (BRDN0001145853)
Plasmid#75668Purpose3rd generation lentiviral gRNA plasmid targeting human MELKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
shCCL20
Plasmid#65096Purposeretroviral expression of CCL20 shRNADepositorAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg1
Plasmid#139450PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tsc2-g2)-PGKpuroBFP-W
Plasmid#105040PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001149147)
Plasmid#76535Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001145887)
Plasmid#76392Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146035)
Plasmid#76081Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001148668)
Plasmid#75639Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001145974)
Plasmid#75497Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode2
Plasmid#229063PurposeExpression mappingDepositorInsertCAG Barcode2
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-lacZ
Plasmid#175175PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting lacZDepositorInsertsgRNA-lacZ
UseAAV and CRISPRAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
ANLN A2.2 gRNA
Plasmid#90531Purpose3rd generation lentiviral gRNA plasmid targeting human ANLNDepositorInsertANLN (Guide Designation A2.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001146855)
Plasmid#77886Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only