We narrowed to 20,805 results for: ATO
-
Plasmid#191093PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertH2B and mScarlet
UseAAVTagsH2B-V5-mScarletExpressionMammalianMutationThe fusion protein was optimized to the Human cod…PromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
HT111_Fsyn_FAS(Cre off)_QuasAr6a_Citrine
Plasmid#178824PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6a_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins6
Plasmid#195043PurposepFA6a derived selection cassette 5' flanked with tDEG1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2 CD
Plasmid#106302PurposeExpresses SHMT2 K280A catalytic site mutantDepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationK280A catalytic site mutation, Silent mutations d…Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1397CN
Plasmid#186203PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1397C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1397N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti_mpx_AsCas12a(dual-gRNA)_h7SK(PacI-ClaI)_U6(I-SceI-NheI)_PGK-puro
Plasmid#189635PurposeLentiviral expression of double dual-AsCas12a gRNAs for generating combinatorial AsCas12a 3Cs librariesDepositorInserth7SK arrayed Cas12a gRNA cassette, hU6 arrayed Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-REX-GECO0.9
Plasmid#61249PurposeExpresses REX-GECO0.9 in neuronsDepositorInsertREX-GECO0.9
UseAAVExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
hSRAP.HMG6.wt.Dlink.a1-236
Plasmid#49813Purposeexpression vector for MBP-SRAP(1-236) fusionDepositorInsertsteroid receptor RNA activator protein (SRA1 Human)
TagsE. coli Maltose Binding ProteinExpressionBacterialMutationwildtype codon-optimized for E. coli expressionPromoterT7Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
hSRAP.TWIN1.a13-215
Plasmid#49817Purposeexpression vector for SRAP(13-215) in pTWIN1 vectorDepositorInsertsteroid receptor RNA activator protein aa 13-215 (SRA1 Human)
Tagsintein & chitin binding domainExpressionBacterialMutationwildtype codon-optimized for E. coli expressionPromoterT7Available SinceJan. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracrRNA-CS1_AsCas12a DRv10
Plasmid#237553PurposeTOPO vector for the cloning of the SpCas9 tracrRNA-CS1 - AsCas12a Direct Repeat (DR) v10 fragment into the pLCHKO_v4 hgRNA vector for scCHyMErA-Seq experiments.DepositorInsertSpCas9.tracrRNA-CS1_AsCas12a DRv10
UseCRISPRAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-miniTurbo-NRF1-FL
Plasmid#237453PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of miniTurbo fused to full-length NRF1 isoformDepositorInsertNRF1 full length
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1/CALR del52-His
Plasmid#214795PurposeBaculovirus expression of human CALR del52-HisDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL(N117Q)
Plasmid#214800PurposeMammalian expression of human MPL(N117Q)DepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL(N178Q)
Plasmid#214801PurposeMammalian expression of human MPL(N178Q)DepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL(N298Q)
Plasmid#214802PurposeMammalian expression of human MPL(N298Q)DepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL(N358Q)
Plasmid#214803PurposeMammalian expression of human MPL(N358Q)DepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR wtΔKDEL
Plasmid#214791PurposeMammalian expression of human CALR wtΔKDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CALR wtΔKDEL-FLAG-KDEL
Plasmid#214792PurposeMammalian expression of human CALR wtΔKDEL-FLAG-KDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-DsRed/MPL
Plasmid#214793PurposeMammalian expression of human MPLDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hIRF5-V5(4D)-LPETG
Plasmid#237225PurposeExpresses LPETG-tagged, constitutively active human IRF5 variant in bacteriaDepositorInsertInterferon regulatory factor 5 (IRF5 Human)
Tags6xHisExpressionBacterialMutationS451D, S453D, S456D, S462DAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Step-FLAG FBXO21
Plasmid#236458Purposetransient overexpression of FBXO21 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIC-His6-MBP-TEV-Rgs14
Plasmid#236395PurposeExpresses His6-MBP-TEV-Rgs14 in E. coliDepositorInsertRattus norvegicus regulator of G-protein signaling 14 (Rgs14 Rat)
Tagshexahistidine (H6) tag and maltose-binding protei…ExpressionBacterialAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKP712/713A
Plasmid#216544PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: P712/713A) of human PTK2DepositorInsertPTK2 (P712/713A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation P712/713AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS732A/S910A
Plasmid#221642PurposeThis retroviral plasmid expresses a double-mutated cDNA (dominant negative: S732A/S910A) of human PTK2DepositorInsertPTK2 (S732A/S910A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK double mutation S732A/S910A (dominant negativ…Available SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKR177/178A
Plasmid#216543PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: R177/178A) of human PTK2DepositorInsertPTK2 (R177/178A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation R177/178AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63(YUM1)
Plasmid#203336Purposeepisomal Cas9 and YUM1-targeting sgRNA expression vector for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
YUM1-targeting sequence
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63
Plasmid#203331Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TAF5-FL_WobbleMut
Plasmid#209053PurposeGateway-compatible entry vector, with insert of the full length TAF5 gene mutated to be resistant to TAF5 siRNADepositorInsertTAF5 full length
UseGateway entry vectorExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TAF5-∆ex8_WobbleMut
Plasmid#209054PurposeGateway-compatible entry vector, with insert of the TAF5 isoform lacking the alternative exon-8 (∆ex8) mutated to be resistant to TAF5 siRNADepositorInsertTAF5 deltaexon-8
UseGateway entry vectorExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2702-AGER-gRNA1
Plasmid#216471Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2704-AGER-gRNA3
Plasmid#216473Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2705-AGER-eGFP
Plasmid#216474Purposedonor vector for targeting an eGFP reporter to the human AGER locus at the endogenous ATG start siteDepositorInserteGFP
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA.v2_U6(SpCas9_I-SceI)-(AsCas12a(dual-gRNA)_PacI-PacI)_PGK-puro
Plasmid#189636PurposeLentiviral expression of single SpCas9 and dual AsCas12a gRNAs for generating combinatorial CHyMErA.v2 3Cs librariesDepositorInserthU6 Cas9-Cas12a-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1333NC
Plasmid#186202PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333N of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333C of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1333CN
Plasmid#186201PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333B of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HT114_Fsyn_FAS(Cre off)_QuasAr6b_Citrine
Plasmid#178825PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6b_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only