167,150 results

#207373

Expression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cells

Ervin Welker

Kulcsar et al Nat Commun. 2023 Sep 16;14(1):5746. doi:

Sept. 25, 2023

Academic Institutions and Nonprofits only

#112284

Fluorescently labels WT human YAP1-2gamma isoform (504 aa)

Erik Sahai

Ege et al Cell Syst. 2018 Jun 27;6(6):692-708.e13.

May 13, 2019

Academic Institutions and Nonprofits only

#191012

Expresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)

Johanna Ivaska

Taskinen et al J Cell Biol. 2020 Jun 1;219(6). pii: 151

Nov. 15, 2022

Academic Institutions and Nonprofits only

#142488

Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.

Feng Zhang

Joung et al Cell. 2023 Jan 5;186(1):209-229.e26. doi

Jan. 5, 2023

Academic Institutions and Nonprofits only

#10792

pcDNA3 vector with added Flag, HA tags

William Sellers

Dec. 7, 2005

Academic Institutions and Nonprofits only

#227734

Homology repair plasmid for endogenous tagging of AP1muA at the C-terminus with TurboID and a V5 epitope tag. Contains a G418 resistance cassette for selection of edited cells.

Francesca Bottanelli

Stockhammer et al J Cell Sci. 2024 Aug 15;137(16):jcs26195

Jan. 3, 2025

Academic Institutions and Nonprofits only

#48201

retroviral vector encoding for GFP and Cre-recombinase

Fred Gage

Zhao et al J Neurosci. 2006 Jan 4. 26(1):3-11.

Jan. 7, 2014

Academic Institutions and Nonprofits only

#217533

Genetically encoded fluorescent probe for labelling endogenous excitatory synapses on PV interneurons in vivo

Peter Scheiffele

Okur et al bioRxiv 2023

April 11, 2024

Academic Institutions and Nonprofits only

#211007

Mammalian expression of full-length human DDB1. C-terminal HaloTag.

Cheryl Arrowsmith

Ackloo et al J Med Chem. 2025 Jan 23;68(2):1092-1112.

Feb. 21, 2024

Industry, Academic Institutions, and Nonprofits