We narrowed to 2,383 results for: neurod
-
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
GST-FUS ΔNLS 1-513
Plasmid#44984DepositorInsertFUS ΔNLS (1-513aa) (FUS Human)
UseTagsGSTExpressionBacterialMutationcontains amino acids 1-513PromotertacAvailable sinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorInsertCSF1R (CSF1R Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TH1150-pOCC177-FUS(Nhe)-PLD_YtoF_RGG_RtoK
Plasmid#221889PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn PLD all Tyr (Y) changed to Phe (F), in RGG (aa…PromoterPH promoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28.His.3C.86b.8D2Q.Tau2N4R
Plasmid#226400PurposeExpresses his-tagged, 3C-cleavable, 86b (split luciferase fragment)-tagged 8D2Q mutant 2N4R tau for recombinant protein production in bacteriaDepositorInsertTau (MAPT synthetic, Human)
UseTagsHis.3C.86bExpressionBacterialMutation8D2Q.Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28.His.3C.86b.20D3Q.Tau2N4R
Plasmid#226401PurposeExpresses his-tagged, 3C-cleavable, 86b (split luciferase fragment)-tagged 20D3Q mutant 2N4R tau for recombinant protein production in bacteriaDepositorInsertTau2N4R (MAPT synthetic, Human)
UseTagsHis.3C.86bExpressionBacterialMutation20D3Q, Tau2N4RPromoterAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH0994-pOCC177-Fus-wt_(1-211)
Plasmid#221886PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationPLD domain (aa 1-211)PromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1148-pOCC177-FUS(Nhe)-PLD_YtoF
Plasmid#221887PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn PLD all Tyr (Y) changed to Phe (F)PromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1149-pOCC177-FUS(Nhe)-RGG_RtoK
Plasmid#221888PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
UseTags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn RGG (aa 212-526) most of Arg (R) changed to Ly…PromoterPH promoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-NE
Plasmid#215487PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2E)-NE
Plasmid#215488PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to glutamate) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to EPromoterUbcAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-GFP
Plasmid#215490PurposeLentiviral expression and easy visualization of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2E)-GFP
Plasmid#215491PurposeLentiviral expression and easy visualization of mutated alpha-synuclein (2nd amino acid aspartate mutated to glutamate) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationD (second aa) mutated to EPromoterUbcAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Kv1.1 K+ channel scFv [K20/78]
Plasmid#182065PurposeMammalian Expression of Kv1.1 K+ channel scFv. Derived from hybridoma K20/78.DepositorInsertrecombinant mouse scFv targeting Kv1.1 K+ channel (Rattus norvegicus) (Kcna1 Mouse)
UseTagsSortase, HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv3.3 K+ channel [N375/67R]
Plasmid#182113PurposeMammalian Expression Plasmid of anti-Kv3.3 K+ channel (Mouse). Derived from hybridoma N375/67.DepositorInsertanti-Kv3.3 K+ channel (Mus musculus) recombinant mouse monoclonal antibody (Kcnc3 Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorInsertsgATM (Atm Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorInsertGFP, sgHTT and sgCas9 (HTT Human)
UseAAV and CRISPRTagsExpressionMutationPromoterEFS and U6Available sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ERBB4-COMP5AP-AviTag-9xHis
Plasmid#157495PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertERBB4 (ERBB4 Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Kv1.1 K+ channel scFv [K20/78]
Plasmid#190486PurposeMammalian Expression of Kv1.1 K+ channel scFV. Derived from hybridoma K20/78.DepositorInsertKv1.1 K+ channel (Rattus norvegicus) recombinant scFV (Kcna1 Mouse)
UseTagsHA, Sortase, 6xHisExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Kv3.3 K+ channel scFv [N375/67]
Plasmid#190549PurposeMammalian Expression of Kv3.3 K+ channel scFV. Derived from hybridoma N375/67.DepositorInsertKv3.3 K+ channel (Mus musculus) recombinant scFV (Kcnc3 Mouse)
UseTagsHA, Sortase, 6xHisExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv3.3 K+ channel [N375/67R]
Plasmid#177537PurposeMammalian Expression Plasmid of anti-Kv3.3 K+ channel (Mouse). Derived from hybridoma N375/67.DepositorInsertanti-Kv3.3 K+ channel (Mus musculus) recombinant mouse monoclonal antibody (Kcnc3 Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-30G+30S-12F+12Y
Plasmid#178687PurposeBacterial expression of N-terminally 6His tagged A1-LCD with thirty Gly residues replaced with Ser, twelve Phe residues replaced with Tyr (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-30G+30S-12F+12Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationthirty Gly residues replaced with Ser, twelve Phe…PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-30G+30S+7F-7Y
Plasmid#178686PurposeBacterial expression of N-terminally 6His tagged A1-LCD with thirty Gly residues replaced with Ser, seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-30G+30S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationthirty Gly residues replaced with Ser, seven Tyr …PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-20G+20S+7F-7Y
Plasmid#178688PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty Gly residues replaced with Ser, seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-20G+20S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty Gly residues replaced with Ser, seven Tyr …PromoterAvailable sinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-14N-4Q+18G
Plasmid#178694PurposeBacterial expression of N-terminally 6His tagged A1-LCD with fourteen Gln residues removed, four Asn removed, replaced with eighteen Gly (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-14N-4Q+18G (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationfourteen Gln residues removed, four Asn removed, …PromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD-20G+20S-12F+12Y
Plasmid#178689PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty Gly residues replaced with Ser, twelve Phe residues replaced with Tyr (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-20G+20S-12F+12Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty Gly residues replaced with Ser, twelve Phe…PromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+23G-23S-12F+12Y
Plasmid#178691PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty-three Ser residues replaced with Gly, twelve Phe residues replaced with Tyr (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+23G-23S-12F+12Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty-three Ser residues replaced with Gly, twel…PromoterAvailable sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+23G-23S+7F-7Y
Plasmid#178690PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twenty-three Ser residues replaced with Gly, seven Tyr replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+23G-23S+7F-7Y (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationtwenty-three Ser residues replaced with Gly, seve…PromoterAvailable sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro--
Plasmid#169716PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available sinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Perfect Mix
Plasmid#169718PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids. TYR and PHE shuffled into 5 clusters.DepositorInserthnRNPA1 (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available sinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only