We narrowed to 5,097 results for: puc
-
Plasmid#232427PurposeExpression plasmid to produce ENVLPE+ particlesDepositorInsertENVLPE+
ExpressionMammalianPromoter2xCMVAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PTRE-tight-flex-hM3Dq-mCherry-WPRE-pA
Plasmid#115161PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM3Dq receptor expression requires both neural activity and Cre recombinase.DepositorInsertsPTRE - tet activator responsive promoter
flex sequence
hM3dq-mCherry (inverted)
flex sequence
UseAAVTagshM3Dq-mCherryExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExodus CMV.Artemis
Plasmid#40211PurposeMammalian expression of codon-optimized Artemis.DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
hTph2p-Luc
Plasmid#223526PurposeFirefly-luciferase reporter expression driven by human Tph2 promoterDepositorInsertTph2 promoter (TPH2 Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromoterhTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-actin prom-dsRed-adra2a.1227.shRNA
Plasmid#67880Purposeexpresses dsRed and shRNA to knock down adra2a receptorsDepositorInsertdsRed and shRNA to knock down the mouse adra2 receptor
UseAAVExpressionMammalianPromoterchicken beta actinAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-DIO-GCaMP6s
Plasmid#184284PurposeExpresses GCaMP6s in genetically defined neurons expressing Cre recombinaseDepositorInsertCCaMP6s
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFPExpressionMammalianPromoterhuman synaptophysinAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-GCaMP6s
Plasmid#183809Purposehis plasmid is for use with neuronal cell-type selective activity tagging. The GCaMP6 expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene TetO promoter-DIO/flex-GCaMP6
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsynapsin-DIO-scramble shRNA - mCherry
Plasmid#245064PurposeAAV transgene designes to express scramble (control) shRNA sequence cell-type selectively. Scramble hairpin expressed from the mir30 cassette together with mCherry.DepositorInsertAAV-DIO-scramble-shRNA-mCherry
UseAAV, Cre/Lox, and RNAiTagsmCherryExpressionMammalianPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
ExpressionBacterial and MammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p36.pA.NGFR.mCMV.hPGK.mGLuc(flag).WPRE[sequenced]
Plasmid#226731Purposebackbone vectorDepositorTypeEmpty backboneExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
P30.pA.NGFR-mSrtA.mCMV.hPGK.GFP.wpre
Plasmid#226728Purposebackbone vector, GFP expressionDepositorTypeEmpty backboneExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p33.pA.NGFR-mSrtA(Pasqual)-flag.mCMV.hPGK.GFP.wpre[sequenced]
Plasmid#226730Purposesortase A(Pasqual) in p30DepositorInsertsortase A (srtA Synthetic)
ExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCW01
Plasmid#72300PurposeStarting substrate for in vitro DNA mismatch repair substrate monitored by PstI cleavage. Derived from pUC19CPDrev H. HWang and J.B. Hays 2002 JBC 277:26136.DepositorTypeEmpty backboneUseDerivative of puc19ExpressionBacterialPromoterlacAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pChimera
Plasmid#61476PurposeVector for conventional cloning that contains AtU6-26 promoter and sgRNA backboneDepositorInsertU6-26:sgRNA
UseCRISPRExpressionPlantPromoterU6-26Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCW02
Plasmid#72301PurposeStarting substrate for in vitro DNA mismatch repair substrate monitored by FauI cleavage. Derived from pUC19CPDrev H. HWang and J.B. Hays 2002 JBC 277:26136.DepositorTypeEmpty backboneUseDerivative of puc19ExpressionBacterialPromoterlacAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Drp1(A395D)-StrepII
Plasmid#174430PurposeExpresses human Drp1 Isoform 3 with A395D mutation in bacteriaDepositorInsertDrp1
TagsStrepIIExpressionBacterialMutationA395DPromoterT7Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only