We narrowed to 5,029 results for: CAPS;
-
Plasmid#224449PurposeRep/Cap plasmid for the production of MyoAAV 4B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYTSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4D
Plasmid#224451PurposeRep/Cap plasmid for the production of MyoAAV 4D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4C
Plasmid#224450PurposeRep/Cap plasmid for the production of MyoAAV 4C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYTSM insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3C
Plasmid#224444PurposeRep/Cap plasmid for the production of MyoAAV 3C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYSSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3B
Plasmid#224443PurposeRep/Cap plasmid for the production of MyoAAV 3B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYSGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_05
Plasmid#194666PurposeProtein production of the split HaloTag based calcium recorder Caprola_05 in bacteriaDepositorInsertCaprola_05
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.V2
Plasmid#127848Purposenon-standard AAV2 rep-AAV-PHP.V2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.V2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_13
Plasmid#194674PurposeProtein production of the split HaloTag based calcium recorder Caprola_13 in bacteriaDepositorInsertCaprola_13
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B4
Plasmid#127849Purposenon-standard AAV2 rep-AAV-PHP.B4 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B4 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_01
Plasmid#194662PurposeProtein production of the split HaloTag based calcium recorder Caprola_01 in bacteriaDepositorInsertCaprola_01
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-CMV2 ACAP1
Plasmid#15697DepositorAvailable SinceNov. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pESC-NAT-LACap
Plasmid#80763PurposeExpresses truncated L-A capsid for curing satellite virusDepositorInsertL-A cDNA (L-A Cap)
ExpressionYeastPromoterPGK1Available SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
iCAP-BI155-KanR
Plasmid#209527PurposeRepCap for AAV productionDepositorInsertAAV-BI155 Cap
ExpressionMammalianAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEntry_MERS-CoV-Nucleocapsid
Plasmid#168833PurposeGateway-compatible Entry vectorDepositorInsertMERS-CoV-Nucleocapsid (N )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-HKU1-Nucleocapsid
Plasmid#168906PurposeGateway-compatible Entry vectorDepositorInsertHCoV-HKU1-Nucleocapsid (N )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1C
Plasmid#196685PurposeRep/Cap plasmid for the production of PAL1C, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_SARS-CoV-1-Nucleocapsid
Plasmid#168852PurposeGateway-compatible Entry vectorDepositorInsertSARS-CoV-1-Nucleocapsid (N )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_09
Plasmid#194670PurposeProtein production of the split HaloTag based calcium recorder Caprola_09 in bacteriaDepositorInsertCaprola_09
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.2
Plasmid#196682PurposeRep/Cap plasmid for the production of M.Mus.2, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationREQQKLW insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only