We narrowed to 14,223 results for: Cas9
-
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regi…Available sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pspCas9-HF-tetra-com-vector
Plasmid#132555PurposeVector plasmid expressing high fidelity spCas9 (R691A) and sgRNA scaffold with com replacing the Tetraloop.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsHigh fidelity Cas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable sinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
AV13_pCAG.Cas9.gRNA.NT
Plasmid#199260PurposeExpression construct encoding SpCas9 nuclease and a control non-targeting guide RNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9 nuclease
Non-targeting (NT) control gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDJ231 - Phsp Cas9
Plasmid#191382PurposeHeat shock inducible Cas9 expression in C. elegans.DepositorInsertPhsp-16.41 Cas9 gpd-2 tagRFP-t
UseCRISPRExpressionWormPromoterPhsp-16.41Available sinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p2T-U6-sgGAA
Plasmid#232724PurposeCas9 guide RNA targeting GAA repeats for A-to-G base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 gRNA targeting GAA repeats
ExpressionMammalianAvailable sinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2_NBT:Cas9green; erbb2_gRNA171
Plasmid#199337PurposepDEL134; transgenic construct to express cell-specific Cas9 in neurons; ubiquitous erbb2 sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsNBT
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
BB1_23_dCAS9(3xFLAG_SV40NLS)
Plasmid#161478PurposeBB1 encoding a FLAG tagged dCAS9 with a SV40 NLSDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCAS9
UseCRISPR and Synthetic BiologyTagsFLAG Tag, SV40 NLSAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_Cas9–superNLS
Plasmid#232430PurposeExpression plasmid for the SpCas9 nuclease with superNLSDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9–superNLS
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAT15542_nCBE-SuperFi-Cas9
Plasmid#184372PurposeMammalian expression of SuperFi-Cas9 CBE base editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q10…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15544_nABE-SuperFi-Cas9
Plasmid#184374PurposeMammalian expression of SuperFi-Cas9 ABE7 base editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q10…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDonor_hU6
Plasmid#69312PurposesgRNA scaffold and human U6 promoterDepositorInserthU6 promoter and sgRNA scaffold flanked by BbsI sites
UseCRISPRPromoterhuman U6 promoterAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-LSD1-Hygro
Plasmid#104406Purposetransient expression of dCas9-LSD1 fusion proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLSD1 (KDM1A Human)
UseCRISPRExpressionMammalianMutationIRATp970A0364D (Source Bioscience) has a P405H ch…PromoterCMV promoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only