We narrowed to 26,935 results for: gfp gene
-
Plasmid#185343PurposeExpression of soluble G2BR, amino acids 378-404 of human AUP1DepositorAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only
-
EGFP-QQN
Plasmid#193563PurposeExpresses human Clathrin Light Chain B mutant (residues 20-22 were substituted from EED to QQN) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationChanged from EED to QQN at residue 20-22PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-nCLC
Plasmid#193564PurposeExpresses human Clathrin Light Chain B (neuronal isoform) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationNeuronal isoformPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(5)
Plasmid#193573PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 5 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(6)
Plasmid#193574PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 6 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(7)
Plasmid#193575PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 7 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-ShadowY
Plasmid#193555PurposeExpresses mEGFP-ShadowY in mammalian cells.DepositorInsertShadowY
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLCdeltaN
Plasmid#193562PurposeExpresses human Clathrin Light Chain B truncation mutant (deleted 1-89 aa) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 1-89PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFPV25.1_dGFPmut3-LVA
Plasmid#187378PurposerpsM promoter driving the expression of destabilized GFPmut3 (containing a LVA C-terminal tail)DepositorInsertdGFPmut3_LVA
TagsLVAExpressionBacterialMutationC-terminal LVA tailAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRnc-gGFP129
Plasmid#189537PurposeExpresses E. Coli RNase III under control of pBAD promoter and constitutively expresses gUTR-129-GFPDepositorInsertsRNase III
gUTR-129-GFP
ExpressionBacterialMutationN/APromoterJ23119 and pBADAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_GFP11-14-SEPT7
Plasmid#180342Purposemammalian expression of human SEPT7 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1-14-GFP11
Plasmid#180344Purposemammalian expression of human SEPT9_i1 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP10
Plasmid#180345Purposemammalian expression of human SEPT9_i3 fused to GFP10DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP11
Plasmid#180346Purposemammalian expression of human SEPT9_i3 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
W118-1_eGFP
Plasmid#180379Purposelentiviral transduction of eGFP geneDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWPT-mEGFP
Plasmid#190606PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)DepositorInsertsmEGFP
mCherry
UseLentiviralMutationa deletion was created in mCherry CDS impairing i…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
p09008_AF1-4+GFP5-7
Plasmid#173715PurposePlasmid backbone for the HyperXpress workflow containing new to nature hybrid GFP with strong fluorescence in E. coli cell free protein synthesis extracts.DepositorInsertshybrid GFP
mKate2
UseE. coli cell free protein synthesis extractsExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-SpGalpha-i
Plasmid#185568Purposeto see protein dynamicsDepositorInsertGalpha-i
UseIn vitro transcription (mrna synthesis)TagsGFP, S-TagAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
phABCA3-eGFP_CRISPR_Donor
Plasmid#188540PurposeHomologous recombination donor plasmid for CRISPR/Cas9 targeting of GFP fusion protein to the stop codon of endogenous human ABCA3 gene locusDepositorInsertEGFP
UseCRISPR; Donor for homologous recombinationAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72 (B11)
Plasmid#185859PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 element using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M3(2*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-eGFP-P(11)4
Plasmid#185786PurposeEncodes enhanced green fluorescent protein linked to P(11)4 self-assembling peptide via a GS-linker sequenceDepositorInserteGFP-P(11)4
TagsHis-tagExpressionBacterialPromoterT7Available SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-HsSyx3
Plasmid#179289PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + GFP + TEV protease cleavage siteDepositorInsertSyx
TagsHis6 + GFP + TEV protease cleavage siteExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7Available SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-(L)-mApple
Plasmid#182856PurposeHetero-dimer expression vectorDepositorInsertmEGFP-mApple
ExpressionMammalianAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Ub-VPS13D
Plasmid#176462Purposeexpressing GFP-Ub marked VPS13D in mammalian cells. GFP-Ub will be cleaved by DUBs to express untagged VPS13DDepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAAAG
Plasmid#170096PurposedeGFP reporter plasmid with CAAAG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAATG
Plasmid#170097PurposedeGFP reporter plasmid with CAATG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-GTAAT
Plasmid#170098PurposedeGFP reporter plasmid with GTAAT PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-GTATT
Plasmid#170099PurposedeGFP reporter plasmid with GTATT PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-ATAAC
Plasmid#170095PurposedeGFP reporter plasmid with ATAAC PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
FKBP-ST*-GFP
Plasmid#163669PurposeExpresses FKBP tagged partial length ST in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (first 113 amino acids) (ST6GAL1 Human)
TagsFK506 binding protein (FKBP) and GFPExpressionMammalianMutationThis chimera contains the first 113 amino acids o…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cavin4b-EGFP
Plasmid#176011PurposeMammalian expression of zebrafish Cavin4b-EGFP. Parton lab clone HXMDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-CT-Tagging
Plasmid#165871PurposeTemplate for amplification of EGFP C-terminal tagging cassetteDepositorInsertVector - CT Tagging
UseSynthetic BiologyAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP*
Plasmid#175237PurposeBacterial expression and purification, low affinity SUMOylation substrate, point mutation F562A reduces affinity for E2, increasing the KmDepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.EFS.eGFP.mArid3a-3'UTR-WT
Plasmid#169299PurposeConstitutive overexpression of the 3'UTR of the murine Arid3a gene after a GFP, to evaluate miRNA binding. Regions not containing miR-125b or let-7c binding regions not included.DepositorAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP
Plasmid#175235PurposeBacterial expression and purification, high affinity SUMOylation substrateDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR-ctrl.PGK.sfGFP.P2A.Tet3G
Plasmid#169316PurposeDoxycycline-inducible expression of miR-ctrl with dTomato as reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsdTomatoPromoterTREAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-ctrl
Plasmid#169305PurposeConstitutive overexpression of miR-ctrl with GFP as a reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsEGFPPromoterSFFVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NT-Tagging
Plasmid#165868PurposeTemplate for amplification of EGFP N-terminal tagging cassetteDepositorInsertVector - NT Tagging
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP TL1
Plasmid#165834PurposesfGFP green fluorescent protein for N-terminal taggingDepositorInsertEGFP
ExpressionInsectAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP TL5
Plasmid#165835PurposesfGFP green fluorescent protein for C-terminal taggingDepositorInsertEGFP
ExpressionInsectAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAFNF-EGFP
Plasmid#163609PurposeExpresses EGFP Flp-dependently in mammalian cellsDepositorInsertEgfp
ExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcry:mCherry,-600unc:cct3GFP
Plasmid#172528PurposealphaA-crystallin promoter (cry) drives mCherry expression in the lens. The 600bp unc-45b muscle-specific promoter drives expression of GFP-tagged zebrafish cct3.DepositorInsertcct3-GFP
ExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.KRAB-mArid3a.IRES.GFP
Plasmid#169306PurposeConstitutive overexpression of murine KRAB-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP–acVHH–PB
Plasmid#169685PurposeAn anti-caffeine nanobody responds to caffeine to induce dimerization of a phospholipid-binding polybasic domain with subsequent plasma membrane translocation.DepositorInsertanti-caffeine nanobody
Tagsmodified STIM1-PB tagExpressionMammalianPromoterCMVAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.VP64-mArid3a.IRES.GFP
Plasmid#169313PurposeConstitutive overexpression of murine VP64-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only