We narrowed to 1,843 results for: rigi
-
Plasmid#27149DepositorInserttoll-like receptor 4(Lps) (Tlr4 Mouse)
UseTags3x FLAGExpressionMammalianMutationchanged Proline 712 to Histidine. Native signal p…PromoterAvailable SinceFeb. 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
RAMA-bio
Plasmid#47786PurposeExpresses enzymatically monobiotinylated full-length RAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAMA
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PTEX150-bio
Plasmid#47788PurposeExpresses enzymatically monobiotinylated full-length PTEX150 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PTEX150
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP9-bio
Plasmid#47740PurposeExpresses enzymatically monobiotinylated full-length MSP9 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP9
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(W66)
Plasmid#63217PurposeExpression of the Celeste (cyan) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(W66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
P12-bio
Plasmid#47725PurposeExpresses enzymatically monobiotinylated full-length P12 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
CLAG3.2-bio
Plasmid#47797PurposeExpresses enzymatically monobiotinylated full-length CLAG3.2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised CLAG3.2
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
ASP-bio
Plasmid#47745PurposeExpresses enzymatically monobiotinylated full-length ASP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised ASP
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RAP1-bio
Plasmid#47794PurposeExpresses enzymatically monobiotinylated full-length RAP1 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAP1
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RhopH2-bio
Plasmid#47798PurposeExpresses enzymatically monobiotinylated full-length RhopH2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH2
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
UseTagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PTRAMP-bio
Plasmid#47793PurposeExpresses enzymatically monobiotinylated full-length PTRAMP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PTRAMP
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
H101-bio
Plasmid#47733PurposeExpresses enzymatically monobiotinylated full-length H101 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised H101
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RH1-bio
Plasmid#47748PurposeExpresses enzymatically monobiotinylated partial RH1 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RH1 (partial)
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNF-KB-Split PS Intein-C tTA
Plasmid#242035PurposeC-terminal segment of a blue-light-controlled split PS Intein tTA gene expression system, co-expressing mCherry under an NF-KB-inducible promoterDepositorInsertSplit PS Intein-C tTA
UseTagsmCherryExpressionMammalianMutationThe CMV promoter in the original vector was repla…PromoterNF-KBAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA ITPA
Plasmid#237998PurposeInducible lentiviral expression of ITPADepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA MPG Catalytic Inactive
Plasmid#237807PurposeLentiviral vector expressing Catalytic Inactive MPGDepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDA2ScIfm
Plasmid#193786PurposeExpresses frame-shifted CI under the control of PLTATAA synthetic promoter, carries a synthetic fragment with additional restriction sites, ColE1 origin of replication, Ampicillin selectionDepositorInsertFrame-shifted CI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPLTATAA synthetic promoter carrying binding sites…Available SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLA2ScIfmTcIfm
Plasmid#193792PurposeCassette 1: Expresses frame-shifted CI under PLLacO-1 promoter, Cassette 2: Expresses frame-shifted CI under PLTetO-1 promoter, ColE1 origin of replication, Ampicillin selectionDepositorInsertTwo copies of frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPLLacO-1 and PLTetO-1Available SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only