We narrowed to 3,505 results for: cgas
-
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001145259)
Plasmid#77734Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN3
Plasmid#125773Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN3 (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1E gRNA (BRDN0001147318)
Plasmid#77977Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1EDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-KIKO-U6-gTgfbr2-p2a-mCherry-STOPpA-400
Plasmid#249131Purposeall-in-one HDRT-based knockin-knockout (KIKO) design to insert mCherry (=knockin) at gTgfbr2 cut site, disrupting Osmr expression (=knockout)DepositorInsertgTgfbr2, mCherry (Tgfbr2 Mouse, Synthetic)
UseAAVAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-2
Plasmid#251686PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast
Plasmid#208348PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK13DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgCdkn1a.2
Plasmid#227946PurposesgRNA targeting Cdkn1a, mCherry, puromycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-1
Plasmid#184536PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(POU5F1_g15-14)-PGKpuroBFP-W
Plasmid#211981PurposeExpress gRNA against POU5F1 with puro and BFPDepositorInsertsgRNA targeting POU5F1 (POU5F1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETV4_5-2)-PGKpuroBFP-W
Plasmid#211961PurposeExpress gRNA against ETV4 with puro and BFPDepositorInsertsgRNA targeting ETV4 (ETV4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-SE(96))-PGKpuro2ABFP-W
Plasmid#200477PurposeLentiviral vector expressing gRNA targeting human CXCR4-SEDepositorInsertCXCR4-SE(96) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGR1B-Fc(DAPA)-AviTag-6xHis
Plasmid#156588PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGR1B (FCGR1B Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_1
Plasmid#195134PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErich3#1/Cre
Plasmid#193211PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Erich3 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCHAT)-PGKpuro2ABFP-W
Plasmid#163147PurposeLentiviral gRNA plasmid targeting human CHAT gene, co-expression of BFP tagDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2ABFP-W
Plasmid#163175PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2ABFP-W
Plasmid#163174PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2c#1/Cre
Plasmid#173583PurposeExpresses a Cdkn2c-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cdkn2c (Cdkn2c Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2)
Plasmid#171099PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Ascl1.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Kmt2c-1
Plasmid#162531PurposesgRNA targeting Kmt2cDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Kmt2b-1
Plasmid#162535PurposesgRNA targeting Kmt2bDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-CAG-CD90.2-Rluc_miR
Plasmid#163331PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the CAG promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-7
Plasmid#129047Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA7 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA7 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
Plasmid#113155PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporterDepositorInsertTwo gRNAs for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001145659)
Plasmid#78010Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001148068)
Plasmid#77403Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAST1 gRNA (BRDN0001148956)
Plasmid#76124Purpose3rd generation lentiviral gRNA plasmid targeting human MAST1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001146190)
Plasmid#76032Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only