We narrowed to 7,705 results for: alp
-
Plasmid#161406PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC51A (SLC51A Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHAGE-PIK3R1-S460_D464delSREYD
Plasmid#116605PurposeLentiviral expression of PIK3R1 S460_D464delSREYDDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
AKT1 gRNA (BRDN0001149266)
Plasmid#75501Purpose3rd generation lentiviral gRNA plasmid targeting human AKT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSN25
Plasmid#100110Purposeexpresses a chimeric SOX2-repressor fusionDepositorUseLentiviralExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SaRFN
Plasmid#85755PurposeExpresses S.aureus FokI-dCas9-NLS with a 36 amino acid GSAT linker fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Backbone derived from pSQT1601 (Addgene #53369).DepositorInsertCsy4-T2A-FokI-SadCas9
UseCRISPRTags3xHA tag, Csy4, and FokI fusion via 36 amino acid…ExpressionMammalianMutationD10A, N580APromoterCAGAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-K379E
Plasmid#116596PurposeLentiviral expression of PIK3R1 K379EDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-MOSPD2 W201E
Plasmid#186471PurposeExpression of human MOSPD2 (mutant W201E, unable to bind lipid droplets) fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationW201E (no more binding to lipid droplets)Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dCTNNA1
Plasmid#176032PurposeA knock-out vector for dog CTNNA1 (alpha-1-catenin)DepositorInsertA gRNA targeting the dog CTNNA1 (alpha-1-catenin) gene and the cDNA of Cas9 (CTNNA1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PPP2R1A-V525A
Plasmid#116609PurposeLentiviral expression of PPP2R1A V525ADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-Q455_K459delQFQEK
Plasmid#116602PurposeLentiviral expression of PIK3R1 Q455_K459delQFQEKDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-W333R
Plasmid#116606PurposeLentiviral expression of PIK3R1 W333RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-N564D
Plasmid#116600PurposeLentiviral expression of PIK3R1 N564DDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-K567E
Plasmid#116597PurposeLentiviral expression of PIK3R1 K567EDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-G376R
Plasmid#116592PurposeLentiviral expression of PIK3R1 G376RDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-G644S
Plasmid#116593PurposeLentiviral expression of PIK3R1 G644SDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-H669Q
Plasmid#116594PurposeLentiviral expression of PIK3R1 H669QDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-D560G
Plasmid#116585PurposeLentiviral expression of PIK3R1 D560GDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-E439delE
Plasmid#116587PurposeLentiviral expression of PIK3R1 E439delEDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-E451delE
Plasmid#116588PurposeLentiviral expression of PIK3R1 E451delEDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-F646S
Plasmid#116590PurposeLentiviral expression of PIK3R1 F646SDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIK3R1_WT
Plasmid#82310PurposeGateway Donor vector containing PIK3R1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001149371)
Plasmid#75753Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DNMT3ACD-CRY2-EGFP
Plasmid#82556PurposeEncodes DMNT3 under LITE2.0 systemDepositorUseAAVTags2A, NLS(alpha-imp), and NLS-VP64ExpressionMammalianMutationCRY2PHR (N-terminal photolyase homology region do…PromoterEF-1alphaAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSN33
Plasmid#100118Purposeexpresses a chimeric KLF4-repressor fusionDepositorUseLentiviralExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hRSK3(RPS6KA2)_K91A_K444A
Plasmid#180385Purposelentiviral transduction of human RSK3 (RPS6KA2) gene with point mutations (K91A and K444A) that inactivate kinase activityDepositorInsertRPS6KA2_K91A/K444A (RPS6KA2 Human)
UseLentiviralExpressionMammalianMutationK91A/K444APromoterCMVAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
TET1CD-CRY2-EGFP
Plasmid#82555PurposeEncodes TET1 under LITE2.0 systemDepositorUseAAVTags2A, NLS(alpha-imp), and NLS-VP64ExpressionMammalianMutationCRY2PHR (N-terminal photolyase homology region do…PromoterEF-1alphaAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001162256)
Plasmid#76929Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PPP2R1A_p.R258H
Plasmid#81581PurposeGateway Donor vector containing PPP2R1A , part of the Target Accelerator Plasmid Collection.DepositorInsertPPP2R1A (PPP2R1A Human)
UseGateway entry vectorMutationR258H; p.588_589delLA-insRLPromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PIK3R1_WT
Plasmid#81748PurposeGateway Donor vector containing PIK3R1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3R1-E160*
Plasmid#116586PurposeLentiviral expression of PIK3R1 E160*DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
GP1BB
Plasmid#51908PurposeExpresses full-length Platelet glycoprotein Ib beta chain precursor ectodomain in mammalian cells. Stop codon before C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertGP1BB (GP1BB Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationStop Codon at amino acid 149, before CD4, bio and…PromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
PAK1 gRNA (BRDN0001145958)
Plasmid#76464Purpose3rd generation lentiviral gRNA plasmid targeting human PAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001149531)
Plasmid#76928Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFB-EF1a-DIO-Rpl22l1-3xFLAG-2A-GFP
Plasmid#245377PurposeCre-dependent expression of FLAG-tagged Rpl22l1 and EGFP.DepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOET3-6xHis-hSMSr-ΔSAMD
Plasmid#236225PurposeExpress N-terminal His-tagged human SMSr (SAMD8)-sterile alpha motif domain deletion mutant protein in insect cellsDepositorInsertSAMD8 (SAMD8 Human)
TagsHexa histidine tag (6xHis-tag) and enterokinase s…ExpressionInsectMutationsterile alpha motif domain at N-terminal (1-231 b…Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2
Plasmid#226506PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD geneDepositorInsertDGKD (DGKD Human)
TagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10A
Plasmid#229403PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10D
Plasmid#229404PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 IST1 L328D (316-366)(C-Cys)
Plasmid#193035PurposeBacterial expression plasmid for IST1 (316-366) with C-terminal Cysteine for fluorescence polarization binding assays. Contains L328D mutation that diminishes binding to MIT domains.DepositorInsertIST1 (IST1 Human)
Tags6xHis-SumoExpressionBacterialMutationL328D, Residues 316-366, Non-native C-terminal Cy…PromoterT7Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 IST1 L355A (316-366)(C-Cys)
Plasmid#193036PurposeBacterial expression plasmid for IST1 (316-366) with C-terminal Cysteine for fluorescence polarization binding assays. Contains L355A mutation that diminishes binding to MIT domains.DepositorInsertIST1 (IST1 Human)
Tags6xHis-SumoExpressionBacterialMutationL355A, Residues 316-366, Non-native C-terminal Cy…PromoterT7Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFFV-RXRA-Brd 134
Plasmid#219101PurposeTranscription factor RXRA with a specific barcode assigned.DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut1-Luc
Plasmid#223664PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 1DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut2-Luc
Plasmid#223665PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 2DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut3-Luc
Plasmid#223666PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at PRE site 3DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut4-Luc
Plasmid#223667PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at PRE site 4DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgPet-1-hSyn-mCherry-KASH
Plasmid#223227PurposeguideRNA targeting the mouse Pet-1 (Fev)DepositorInsertFev (Fev Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1(13))-PGKpuro2ABFP-W
Plasmid#200501PurposeLentiviral vector expressing gRNA targeting human RUNX1DepositorInsertRUNX1(13) (RUNX1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1(11))-PGKpuro2ABFP-W
Plasmid#200500PurposeLentiviral vector expressing gRNA targeting human RUNX1DepositorInsertRUNX1(11) (RUNX1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only