We narrowed to 7,357 results for: Ank
-
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
TagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1-RspA-NFAST
Plasmid#233606PurposeExpression of hSTIM1-RspA-NFASTDepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-pDEST_BirA_Flag_SLC45A1
Plasmid#227959PurposeBioID experimentDepositorAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737
Plasmid#222472PurposeLuciferase vector containing the hs737 enhancer sequence (reference sequence).DepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 res
Plasmid#214752Purposeexpresses human MR1 resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNFSF11-Fc(DAPA)-AviTag-6xHis
Plasmid#156700PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertTNFSF11 (TNFSF11 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-A457P
Plasmid#193365Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (A457P mutation) (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationA457P (GCC to CCC)PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-R121A/K334A/R440A
Plasmid#193366Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA …PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAres_W
Plasmid#147897PurposeMammalian Expression of HsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-IKGRQtoDSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation10 silent mutations and two non silent N605S, K75…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-NF1144AA-shRNAres_W
Plasmid#147898PurposeMammalian Expression of HsNot1iso1-del1097-1110-NF1144AA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-NF1144AA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-R1138A-shRNAres_W
Plasmid#147899PurposeMammalian Expression of HsNot1iso1-del1097-1110-R1138A-shRNAresDepositorInsertHsNot1iso1-del1097-1110-R1138A-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1079-1110-RNFtoAAA-shRNAres_W
Plasmid#147886PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres_W
Plasmid#147887PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-6xHis-NLS(SV40)
Plasmid#185701PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(FCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha-delCTE
Plasmid#181896PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamates, C-terminal deletionDepositorInsertnE-mHP1alpha-delCTE (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14E, 14 aa C-terminal deletionPromoterCMVAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-FUSN-mHP1alpha
Plasmid#181897PurposeFluorescently tagged HP1alpha fused to the N-terminal domain of the fused in sarcoma protein (FUSN)DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PGL-1-mHP1alpha
Plasmid#181899PurposeFluorescently tagged HP1alpha fused to PGL-1DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRGG-GFP-RGG-mHP1alpha
Plasmid#181898PurposeFluorescently tagged HP1alpha fused to the arginine/glycine-rich RGG domain of LAF-1DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2)
Plasmid#171099PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Ascl1.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ200
Plasmid#162673PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S136C and a sequence Tyr75:Phe104 to introduce a 6th disulfide bond as in AoFaeB-2.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS136C and a sequence Y75-F104 to introduce a 6th…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ210
Plasmid#162683PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S136C, G489C, S530C, and a sequence Tyr75:Phe104 to introduce a 6th and 7th disulfide bond as in AoFaeB-2.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS136C, G489C, S530C, and a sequence Y75-F104 to i…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ220
Plasmid#162686PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224W and C529S mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1) with lid deletion and C224W and C529S mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224W, C529S; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ221
Plasmid#162687PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating lid deletion (Gly251:Thr472) and C224H and C529F mutations from PETase active site.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), with lid deletion and C224H and C529F mutations
TagsHisExpressionBacterialMutationdeltaG251-T472, C224H, C529F; codon optimized for…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3 V908L
Plasmid#136370PurposeExpresses epitope-tagged human TET3 V908L variant in mammalian cellsDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3 V1089M
Plasmid#136369PurposeExpresses epitope-tagged human TET3 V1089M variant in mammalian cellsDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3 A1076T
Plasmid#136368PurposeExpresses epitope-tagged human TET3 A1076C variant in mammalian cellsDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3 R752C
Plasmid#136367PurposeExpresses epitope-tagged human TET3 R752C variant in mammalian cellsDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3 F1072C
Plasmid#136366PurposeExpresses epitope-tagged human TET3 F1072C variant in mammalian cellsDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1499
Plasmid#29247PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle28 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1498
Plasmid#29246PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle27 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1493
Plasmid#29241PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle22 (CCKBR Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1568
Plasmid#29265PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle97 (GPX3 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 21, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1500
Plasmid#29248PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle29 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1215
Plasmid#29109PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceOct. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
DRH015_ AAV-hSyn-WT-THR
Plasmid#225088PurposeExpression of wild-type thyroid receptor beta (THRB, human) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertWT-THRB (THRB Human)
UseAAVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB-CuR-hSOD1
Plasmid#232477PurposeThe inducible PiggyBac Cumate Switch vector (PBQM812A-1 System Biosciences) expressing human SOD1gene including flag -tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-CuOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2
Plasmid#40978DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GFP-fGFP
Plasmid#135631PurposeAAV vector to drive the expression of fGFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGFP-fGFP
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpRY(H840A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES395)
Plasmid#185489PurposeCMV and T7 promoter expression plasmid for human codon usage nSpRY(H840A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpRY(H840A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationH840A/A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N13…PromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a-fDIO-PdCO-mScarlet-miniWPRE
Plasmid#198515PurposeExpresses optimized PdCO in frame with mScarlet under control of eukaryotic Ef1a promoter after Flp-dependent recombination.DepositorInsertPdCO
UseAAV and Cre/LoxTagsRho1D4 and mScarletExpressionMammalianPromoterEF-1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only