We narrowed to 7,572 results for: aav
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-EGFP-P2A-EGFPf-WPRE-HGHpA
Plasmid#74513PurposeAAV vector that use human synapsin-1 promoter to drive the expression of EGFP and membrane-targeted EGFPf linked by self-cleaving P2A peptide.DepositorInsertEGFP-p2A-EGFP-f
UseAAVAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
Plasmid#212829PurposeDoxycycline-inducible (Zim3)KRAB-dCas9-HA-P2A-mCherry cassette for integration at the AAVS1-locus of the human genome.DepositorInsertZIM3-KRAB-dCas9-P2A-mCherry
TagsHA-tag and ZIM3-KRABExpressionBacterial and MammalianPromoterCAG, TetOnAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1277 - pAAV-AiE2051m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214479PurposeAiE2051m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1316 - pAAV-AiE2010m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230526PurposeAiE2010m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-CAGGS-Flex/3'USS-GFP(ATG mut)
Plasmid#197885PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP1862 - pAAV-AiE2566m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214561PurposeAiE2566m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BEC enhancer-minBG-iCre(R279T)-4x6T
Plasmid#236727PurposeBrain Endothelial Cell Enhancer with 4x6T miRNA targeting cassette For use in combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors.DepositorInsertscis-regulatory elements 89763
iCre(R297T)
4x6T miRNA targeting cassette
UseAAVMutationR297TAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV SYN flex PSAM4 GlyR IRES EGFP
Plasmid#119741PurposeCre-dependent chemogenetic inhibitor expressionDepositorHas ServiceAAV5 and AAV9InsertPSAM4 GlyR IRES eGFP (CHRNA7 Human, Synthetic)
UseAAVExpressionMammalianMutationL131G, Q139L, Y217FPromotersynapsinAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP
Plasmid#137140PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-FLEX-NEPLDCV-P2A-mRUBY3-WPRE
Plasmid#207664PurposeNeuropeptide degradationDepositorInsertNEP (MME Human)
UseAAV and Cre/LoxTagsmRUBY3MutationAddition of signaling peptide (POMC) on the N-ter…PromoterhSynapsinAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE
Plasmid#51509PurposeCan be used to generate AAV virus that will express cytoplasmic tdTomato and presynaptic (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorHas ServiceAAV1InserttdTomato-T2A-SypEGFP
UseAAVPromoterphSyn1Available SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-fDIO-mCherry-IRES-WGA-Cre
Plasmid#232905PurposeFlp-dependent anterograde transsynaptic tracerDepositorInsertSyn-fDIO-mCherry-IRES-WGA-Cre
UseAAVExpressionMammalianAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1α-TetOn3G_2x cHS4_pTRE3G-loxP-EGFP-lox2272 [AAVS1]
Plasmid#227246PurposeAll-in-one ROSE LP donor construct for TetOn3G-inducible cell line development in HEK293 cellDepositorInsertsTet-On 3G transactivator protein
Enhanced green fluorescent protein
UseCre/Lox and Synthetic BiologyExpressionMammalianPromoterEF1α and pTRE3GAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-JNKKTRrsGreenF-E-2A-ERKKTRrsFastLime-IRES-PKAKTRClover-2A-P38KTRDronpa
Plasmid#205766PurposeExpression of JNK KTR rsGreenF-E, ERK KTR rsFastLime, PKA KTR Clover, and P38 KTR Dronpa in mamalian cellsDepositorInsertJNK KTR rsGreenF-E-2A-ERK KTR rsFastLime-IRES-PKA KTR Clover-2A-P38 KTR Dronpa
UseAAVExpressionMammalianMutationwtAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP20010 - pAAV-AiE2356m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230554PurposeAiE2356m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#50942PurposeBicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVPromoterhSyn1Available SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
AiP1653 - pAAV-AiE2333m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214506PurposeAiE2333m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Plasmid#92392Purposeproduces AAV expressing Cal-light TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTADepositorInsertTM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyExpressionMammalianPromoterHuman SynapsinAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP1977 - pAAV-AiE2586m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214601PurposeAiE2586m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1307 - pAAV-AiE2016m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214481PurposeAiE2016m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP20141 - pAAV-AiE2356m-minBG-iCre(R297T)-BGHpA
Plasmid#230564PurposeAiE2356m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gat1-HA-WPRE-HGHpA
Plasmid#184635PurposeExpresses the GABA membrane transporter Gat1 fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4s-NGR-WPRE
Plasmid#234453PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1858 - pAAV-AiE2538m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214558PurposeAiE2538m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-Synaptophysin-10xMyc-WPRE
Plasmid#237446PurposeIntersectional expression of Myc-tagged synaptophysin in the presence of Cre and FlpDepositorInsertCon/Fon-Synaptophysin-10xMyc
UseAAVExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA
Plasmid#107270PurposeExpresses Cas9 upon induction with doxicycline.DepositorInsertshSpCas9
rtTA
bGH polyA-SV40polyA
Tags3xFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCAG and TREAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gad67-WPRE-HGHpA
Plasmid#184632PurposeExpresses Gad67, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gad65-WPRE-HGHpA
Plasmid#184631PurposeExpresses Gad65, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFP
Plasmid#51093PurposeForebrain principal neuron expression of oChIEF kinetic variant E163A/T199C with physically uncoupled EGFP fluorophoreDepositorInsertoChIEF(E163A/T199C)
UseAAVTagsP2A-EGFPExpressionMammalianMutationE163A/T199CPromoterCaMKIIaAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLY017SB_pAAV-U6sg(BbsI)-EFS-Thy1.1-P2A-SB100X
Plasmid#192151PurposeT cell CRISPR AAV-SB vectorDepositorTypeEmpty backboneUseAAVExpressionMammalianMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myriRFP670V5-P2A-post-eGRASP
Plasmid#111585PurposeAn AAV vector that expresses double floxed myristoylated iRFP670 with V5 tag and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyriRFP670V5-P2A-post-eGRASP
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP2105 - pAAV-AiE2638m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230551PurposeAiE2638m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-rsChRmine-oScarlet-Kv2.1-WPRE
Plasmid#183529PurposeOptogeneticsDepositorInsertrsChRmine-oScarlet-Kv2.1
UseAAVMutationI146M/G174SPromoterEf1aAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP1010-pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA
Plasmid#163476PurposeDirect-expressing iCre AAV Virus. Alias: AiP1010 - pAAV-AiE2004m-minBG-iCre-WPRE-HGHpADepositorInsertiCre
UseAAVPromoterBeta Globin minimal promoterAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
1530_pAAV-U6-SA-BbsI-MluI-gRNA-HLP-EmGFP-spA
Plasmid#109317PurposePlasmid for liver-specific expression of EmGFP with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RAM-d2TTA::TRE-NLS-mKate2-WPREpA
Plasmid#84474PurposepAAV-RAM-NLS-mKate2DepositorInsertmKate2
UseAAVTagsNuclear localization signal of SV40 large T antig…PromoterTREAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChRmine-oScarlet
Plasmid#137161PurposeIntersectional viral expression of ChRmine-p2a-oScarlet in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChRmine-p2a-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationoScarlet E95DPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP20027 - pAAV-AiE2182m_3xC2-minBG-iCre(R297T)-BGHpA
Plasmid#220735PurposeAiE2182m_3xC2 is an optimized enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVPromoterminBGAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1A-DIO-PSD95.FingR-eGFP-CCR5TC
Plasmid#126216PurposeLabeling of excitatory synapses (green fluorescence) in cre-expressing neuronsDepositorInsertPSD95.FingR-eGFP-CCR5TC
UseAAV and Cre/LoxExpressionMammalianPromoterEF1AAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-hM3Dq-mCherry (Cre-OFF)
Plasmid#166609PurposeEncodes Cre-inactivated hM3Dq-mCherry under control of the TREDepositorInserthM3Dq-mCherry
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-single(U6-sgRNA(backbone))-ITR
Plasmid#207880PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP1427 - pAAV-AiE2135m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214497PurposeAiE2135m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [Jaws-KGC-tdTomato-ER2]
Plasmid#195488PurposeAAV-mediated expression of Jaws-KGC-tdTomato-ER2 under the CAG promoter, in FLPX/reversed (Frt-dependent) manner.DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterCAGAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111581PurposeAn AAV vector that expresses double floxed myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP1357 - pAAV-AiE2128m-minBG-SYFP2-WPRE-BGHpA
Plasmid#220643PurposeAiE2128m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only