We narrowed to 3,021 results for: COB
-
Plasmid#205801PurposeExpress mEGFP-tagged fusion protein, DCAF15_ZNF333 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pENTR-Mm_MyoGEF(T575A)
Plasmid#136328PurposeMouse MyoGEF-T575A mutant in Gateway pENTRDepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Anti-Sense
Plasmid#124444PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Gli3_Sense
Plasmid#124439PurposePlasmid for sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21a-MKP7_K62R_153
Plasmid#37795DepositorInsertMitogen-activated protein kinase phosphatase 7 (DUSP16 Human)
TagsHisExpressionBacterialMutationchanged Lysnie 62 to Arginine and deleted amino a…Available SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET21a-MKP7_K52R_153
Plasmid#37793DepositorInsertMitogen-activated protein kinase phosphatase 7 (DUSP16 Human)
TagsHisExpressionBacterialMutationchanged Lysnie 52 to Arginine and deleted amino a…Available SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-EDB in pMAX
Plasmid#120403Purposeenables eukaryotic expression of human EDB (or EIIIB) containing fibronectin based on plasma fibronectin sequenceDepositorAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-ChR2-mCherry-Fishell-3
Plasmid#83898PurposeChR2-mCherry fusion expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertChR2
UseAAVExpressionMammalianPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpRYc-P2A-EGFP
Plasmid#208336PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpRYcDepositorInserthuman codon optimized CBE4max Cas9 variant named SpRYc with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationSc++ (1-1119), SpRY (1111-1368), D10APromoterCAGAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1
Plasmid#83900PurposeGFP expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserteGFP
UseAAVPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SS18_SSX1
Plasmid#205927PurposeExpress mEGFP-tagged fusion protein, SS18_SSX1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
EFS-SpdCas9-Dnmt3A/3L-WT
Plasmid#222497PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to WT Dnmt3A/3L followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 NSP6
Plasmid#141260PurposeGateway-compatible Entry vector, with insert of NSP6 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorInsertNSP6 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2
Plasmid#83899PurposeGCaMP6f expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertGCaMP6f
UseAAVExpressionMammalianPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 E
Plasmid#141273PurposeGateway-compatible Entry vector, with insert of the envelope (E) gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertE (E SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
NONO2_IDR-EGFP
Plasmid#232758PurposeExpresses NONO2_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only