We narrowed to 573 results for: CH1
-
Plasmid#118615Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR (swap) under doxy-inducible CMV promoterDepositorInsertcdc42E7-E6 3'UTR (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianPromotertetON CMVAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc1)-COMP5AP-AviTag-9xHis
Plasmid#157612PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc1)-Fc(DAPA)-AviTag-6xHis
Plasmid#157048PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNOTCH1 (NOTCH1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
p254-RV-CAG-dio-mScarlet-T2A-Dach1-202
Plasmid#204742PurposeConditional expression of target gene Dach1 with fluorescent reporter mScarletDepositorInsertDach1
UseRetroviralPromoterCAGAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc3)-COMP5AP-AviTag-9xHis
Plasmid#157566PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc2)-COMP5AP-AviTag-9xHis
Plasmid#157547PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc3)-Fc(DAPA)-AviTag-6xHis
Plasmid#157002PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNOTCH1 (NOTCH1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH1(Trunc2)-Fc(DAPA)-AviTag-6xHis
Plasmid#156983PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertNOTCH1 (NOTCH1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 3 HK02 pFUSE-IgG-human kappa VL-CH1 hole-clone2
Plasmid#192185PurposeClone 16 (HK02) pFUSE-IgG-human kappa VL-CH1 hole-clone2DepositorInsertClone 2 light chain (HK02)
ExpressionMammalianMutationNAAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRVL-2
Plasmid#104580PurposeContains mouse IgG2c CH1/CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Full Fc-mediated immune effector functionsDepositorInsertMouse IgG2c CH1/CH2/CH3
ExpressionMammalianPromoterCMVAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-5
Plasmid#104583PurposeContains human IgG1 CH1/CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Full Fc-mediated immune effector functionsDepositorAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-3
Plasmid#104581PurposeContains mouse IgG2c CH1/mutated CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Abolished Fc-mediated immune effector functionsDepositorInsertMouse IgG2c CH1/CH2/CH3 (mutated, no effector functions)
ExpressionMammalianMutationL234A/L235E/G237A and E318A/K320A/K322APromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-6
Plasmid#104584PurposeContains human IgG1 CH1/mutated CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Abolished Fc-mediated immune effector functionsDepositorInsertHuman IgG1 CH1/CH2/CH3 (mutated, no effector functions) (IGHG1 Human)
ExpressionMammalianMutationL234A/L235E/G237A and K322A/P331SPromoterCMVAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM_M18
Plasmid#91729PurposeExpression plasmid coding for heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18.DepositorAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Asp_M18
Plasmid#91781PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Asp (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Asp (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asn209Ala_M18
Plasmid#91733PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asn209Ala (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsn209 changed to Ala (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Arg210Ala_M18
Plasmid#91734PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Arg210Ala (EU numbering).DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationArg210 changed to Ala (EU numbering)PromoterhEF1-HTLV promAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only