We narrowed to 6,098 results for: tTA
-
Plasmid#105525PurposeKnock in H2B-GFP into the human PAX6 locusDepositorInsertPax6 TALEN R
UseTALENTags3x FLAG and NLSExpressionMammalianPromoterCMVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAX6 TALEN L
Plasmid#109034PurposeKnock in H2B-GFP into the human PAX6 locusDepositorInsertPax6 TALEN L
UseTALENTags3x FLAG and NLSExpressionMammalianPromoterCMVAvailable SinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hAIM2-T7
Plasmid#51538PurposeExpress T7-tagged hAIM2 in mammalian cellsDepositorAvailable SinceMarch 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn_NES-His-rsCaMPARI-mRuby3
Plasmid#120805PurposeAAV plasmid for expressing rsCaMPARI in neurons, nucleus excludedDepositorInsertrsCaMPARI
UseAAVTagsNES-His and mRuby3Promoterhsyn (synapsin-1)Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
HOXA9-MSCV-full-GFP
Plasmid#20977DepositorInsertHOXA9 (Hoxa9 Mouse)
UseRetroviralTagsFlagExpressionMammalianMutationFull length cDNA with ~1.1kb 3'UTR with 2 pu…Available SinceJan. 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCVD438
Plasmid#63759Purposeeae gene (3476 bp) from pJY21 removed by SamI/SphI digestion, cloned into EcoRV/SphI sites of pACYC184. Insertional inactivation of tetracycline gene.DepositorInserteae
ExpressionBacterialAvailable SinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pMX1418
Plasmid#127856PurposeExpresses EGFP-IPNN-MCAK in mammalian cellsDepositorInsertIPNN-MCAK
TagsEGFPExpressionMammalianMutationmutation is I97N and P98NPromoterCMVAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC523
Plasmid#62320PurposesgRNA for yeast cellsDepositorInsertsgRNA
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+5'MT-wbp2nl
Plasmid#172467Purposeexpresses myc-tagged version of wild-type proteinDepositorInsertwbp2nl
UseXenopus expressionTagsMycPromoterSP6Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ubp8/PET32a
Plasmid#26965DepositorInsertUbp8 (UBP8 Budding Yeast)
TagsHis6 and TrxExpressionBacterialMutationTEV site is added t the 5' end and 4 alanine…Available SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-CDS
Plasmid#136040PurposeUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Suv39H2_2
Plasmid#36345DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSDMA66
Plasmid#128355PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorInsertNoureothricin (NAT)
UseUnspecifiedPromoterACT1Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CyclinB-GFP
Plasmid#54465PurposeCyclinB-GFP in pIVT vector for in vitro transcriptionDepositorInsertCyclinB
TagsGFPExpressionMammalianMutationK67E and I150T mutations compared to GenBank refe…Available SinceJan. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKDC.015
Plasmid#184992PurposeExpress -Eco2 RT and ncRNA in human cellsDepositorInsertEco2: RT and ncRNA(wt), a1/a2 length: 13
ExpressionMammalianMutationHuman codon optimized RTPromoterTetOn-3gAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn_NLS-His-rsCaMPARI-mRuby3
Plasmid#122092PurposeAAV plasmid for expressing rsCaMPARI in neurons, nucleus localizedDepositorInsertrsCaMPARI
UseAAVTagsNLS-His and mRuby3Promoterhsyn (synapsin-1)Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-3'UTR
Plasmid#136041PurposeUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPERPluc1
Plasmid#14810DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only