159,557 results
-
Plasmid#59152PurposeLentiviral vector to express p38 KTR mClover under PGK promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralTagsExpressionMammalianMutationPromoterPGKAvailable sinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-VP64
Plasmid#47107PurposeExpresses inactivated S. pyogenes dCas9 (D10A, H840A) fused to VP64 transactivator domain in mammalian cellsDepositorInsertdCas9-VP64
UseCRISPRTagsFlag, HA, SV40 NLS, and VP64ExpressionMammalianMutationD10A, H840A (catalytically inactive)PromoterCMVAvailable sinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorInsertFlex-P301L tau (MAPT )
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-OTp-GCaMP6s
Plasmid#192945PurposeTo drive GCaMP6s under the control of mouse oxytocin promoterDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
DRD2-DuET
Plasmid#213228PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertDRD2 (DRD2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-zFGFR1a
Plasmid#232639PurposeZebrafish FGFR1a receptor kinase domain fused to VfLOVDepositorInsertzFGFR1a kinase domain + VfLOV domain
UseTagsExpressionMutationPromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-GFAP-N-18
Plasmid#55051PurposeLocalization: Intermediate Filaments, Excitation: 587, Emission: 610DepositorInsertGFAP (GFAP Human)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-Tev
Plasmid#177142PurposeBacterial vector for expression of an N-terminal GST fusion of the Tev proteaseDepositorInsertTev
UseTagsGSTExpressionBacterialMutationPromoterTacAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only