174,565 results
-
Plasmid#85057PurposeIn vivo visualization of the mitochondria (can be used for colocalization studies)DepositorAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only
-
ATP1A1_plasmid_donor_RD
Plasmid#86551PurposeHomology-directed repair (HDR) donor plasmid with homology arms to ATP1A1 to introduce the Q118R and N129D (RD) mutations conferring cellular resistance to ouabainDepositorInsertATP1A1 (ATP1A1 Human)
UseCRISPR and TALEN; Co-selection via hdr using ouab…ExpressionMammalianMutationQ118R, N129DAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
bZiPro
Plasmid#86846Purposeexpress NS2B-NS3 protease in E.coliDepositorInsertsNS3 1-177
NS2B45-96
Tagsa hexahistidine tag and a thrombin cleavage siteExpressionBacterialMutationNS2B cofactor region (residues 45–96) and NS3 pro…PromoterT7Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCX-HO1-2A-EGFP
Plasmid#74672PurposeMammalian expression of HO1 and EGFPDepositorAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-BFP-backbone
Plasmid#85707PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with a BFP fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCMV10-RBPJ
Plasmid#84601PurposeMammalian expression of FLAG tagged human RBPJDepositorAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Grp1-PH pEGFP-C1
Plasmid#71378PurposeFor analysis of PH domain localization in mammalian cellsDepositorInsertGrp1-PH (Cyth3 Mouse)
TagsEGFPExpressionMammalianMutationPleckstrin homology (PH) domain; aa 247-399PromoterCMVAvailable SinceNov. 2, 2016AvailabilityAcademic Institutions and Nonprofits only