We narrowed to 6,944 results for: crispr cas9 plasmids
-
Plasmid#131045PurposePlasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence.DepositorInsertSpCas9-53BP1-DN1S (TP53BP1 Human)
UseCRISPRTagsGFP and SpCas9ExpressionMammalianMutationOnly expressing residues 1231-1644 of complete 53…PromoterCBHAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTRm
Plasmid#127197PurposepGTRm is the template plasmid for PCR & golden gate assembly driven generation of polycistronic tRNA-gRNA sequencesDepositorInserttRNA-gRNA PCR template
UseTemplate plasmid for generation of golden gate pc…PromoterNoneAvailable SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-Cherry-sgRNA
Plasmid#221387Purposeepisomal (HygR), with constitutive mCherry (Psmyc) and AHT-inducible sgRNA cloning site, including Golden Gate for multiple sgRNAsDepositorInsertnone, cloning vector for introduction of targeting sequences
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML104-KanMx4
Plasmid#83476PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains KanMx4 marker for yeast transformation.DepositorInsertKanMX4
ExpressionYeastAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4
Plasmid#83475PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation.DepositorInsertHphMX4
ExpressionYeastAvailable SinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
ExpressionYeastAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRNF219.1.0-gDNA
Plasmid#132464PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRNF219
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSHZ2.1.0-gDNA
Plasmid#113778PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TSHZ2DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12.1.0-gDNA
Plasmid#113769PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB12DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only