We narrowed to 6,999 results for: crispr cas9 plasmids
-
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV51
Plasmid#179915PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern332
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
LRG (Lenti_sgRNA_EFS_GFP)
Plasmid#65656PurposeLentiviral introduction of sgRNA constitute expression linked with GFP marker into mammalian cell line.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter-driven sgRNA expression and EFS promo…Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Nat
Plasmid#232097PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with NatMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan
Plasmid#232099PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with KanMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg
Plasmid#232098PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with HygMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS272
Plasmid#73728PurposeSapTrap syntron-embedded FLP-on C-terminal connector donor plasmidDepositorInsertsyntron embedded C-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS281
Plasmid#73732PurposeSapTrap syntron-embedded FLP-on N-terminal connector donor plasmidDepositorInsertsyntron embedded N-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458M-53BP1-DN1S
Plasmid#131045PurposePlasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence.DepositorInsertSpCas9-53BP1-DN1S (TP53BP1 Human)
UseCRISPRTagsGFP and SpCas9ExpressionMammalianMutationOnly expressing residues 1231-1644 of complete 53…PromoterCBHAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only