We narrowed to 54,388 results for: plasmid
-
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-H2BC11
Plasmid#227588PurposeLentiviral plasmid expressing human H2BC11 proteinDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS415 GPDpro-RNQ1-CFP
Plasmid#224887PurposeLow copy plasmid for constitutive yeast expression of RNQ1 tagged with CFP using copper. This is construct can be used as an IPOD marker (Kaganovich et al., 2008).DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_gutB
Plasmid#212139PurposeCargo plasmid for integrating PT7 expression cassette of xylitol dehydrogenase in in genome.Plasmid can be removed by incubating cells at 37 C.DepositorInsertxylitol dehydrogenase
ExpressionBacterialPromoterPT7Available SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCT03
Plasmid#212150PurposePlasmid expressing alanine dehydrogenase under inducible promoter PT7 control. The enzyme is thermophilic and works best at 50 C.DepositorInsertalanine dehydrogenase
Tags6x HisExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SynCAM4/pCDNA3
Plasmid#197328PurposePlasmid expressing an antigen targeting NECL4/SynCAM4DepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTNA-c200
Plasmid#205114PurposePTN protein expressionDepositorAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Kv1.1/RBG4
Plasmid#196943PurposePlasmid expressing an antigen targeting the Kv1.1 potassium channel subunitDepositorInsertKv1.1 (Kcna1 Rat)
ExpressionMammalianAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
KChIP2/RBG4; 9QM3/RBG4
Plasmid#196944PurposePlasmid expressing an antigen targeting the KChIP2b potassium channel subunitDepositorInsertKChIP2 (Kcnip2 Rat)
ExpressionMammalianAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
BAF53b + GFP/p-Actin-IRES
Plasmid#197297PurposePlasmid expressing an antigen targeting BAF53bDepositorAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G2-Km ymTurquoise2
Plasmid#193958PurposeTEF1 promoter controlled expression plasmid with G418 resistance for expressing ymTurquoise2 in budding yeastDepositorInsertymTurquoise2
ExpressionYeastPromoterTEF1Available SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only