We narrowed to 27,447 results for: CAT
-
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pADSL-2XStrep
Plasmid#125684Purposeexpresses human ADSL protein with a C-terminal 2XStrep affinity tagDepositorAvailable SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTgR2
Plasmid#107286PurposePlasmid can be used for Drosophila S2 driven secretion of extracellular part of human interferon-_ receptor 2.DepositorInsertInterferon gamma receptor 2 (IFNGR2 Human)
TagsCATCATCACCATCACCATGAExpressionInsectPromoterMetallothionein promoterAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
zgc:153086_R (OZ512)
Plasmid#27187DepositorInsertZinc finger array targeting zgc:153086
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
zgc:153086_L (OZ511)
Plasmid#27186DepositorInsertZinc finger array targeting zgc:153086
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
SDC3_L (OZ595)
Plasmid#35235DepositorInsertZinc finger array targeting SDC3
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
SDC3_R (OZ596)
Plasmid#35236DepositorInsertZinc finger array targeting SDC3
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pUltra-EGFP-P2A-Tr-NRL
Plasmid#239100PurposepUltra-EGFP bi-cistronic lentiviral vector expressing EGFP and truncated NRL.DepositorArticleInsertNeural Retina Leucine Zipper (truncated) (NRL Human)
UseLentiviralAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-C-EF1α-Tr-NRL
Plasmid#239096PurposeExpresses truncated NRL, driven by EF1α promoter.DepositorArticleInsertNeural Retina Leucine Zipper (truncated) (NRL Human)
ExpressionMammalianAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCHC030 (∆CBBp ∆MBH ∆SH)
Plasmid#226205PurposeElectroporation knockout plasmid (pK18sB) to delete the CBBp, membrane-bound hydrogenase, soluble hydrogenase, and intervening sequences (∆CBBp ∆MBH ∆SH).DepositorInsertHomology arms for CBBp, MBH, and SH operons, and intervening sequencessequences.
UseSynthetic BiologyMutation∆cbbR ∆cbbLSXYEFPTZGKA ∆hoxKGZMLOQRTV ∆hypA1B1F1C…Available SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_nmPKA-CαN-mPAGFP
Plasmid#114130PurposeMammalian expression of the G2A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertthe N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric paGFP, with G2A mutation (Prkaca Mouse)
ExpressionMammalianAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN067
Plasmid#91602PurposeExpress sgRNA targeting human DPP4DepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPN170
Plasmid#91599PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CHRFAM7ADelta2bp-YFP
Plasmid#62637Purposemammalian expression of human duplicated Alpha7-2 bp deletion (CHRFAM7A-∆2bp) with YFP fused into M3-M4 loopDepositorInsertCHRFAM7A (CHRFAM7A Human)
ExpressionMammalianMutationthere is a 2-bp deletion in exon 6 of CHRFAM7A an…PromoterCMVAvailable SinceMarch 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Ctnnb1
Plasmid#123586DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dnmt3a3lCD
Plasmid#235576PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Dnmt3a3L fused with scFV to programme DNA methylationDepositorAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAST-pHuji-GINKO2
Plasmid#177117PurposeGenetically encoded green fluorescent potassium ion indicator GINKO2 and red fluorescent pH indicator pHuji fusionDepositorInsertpHuji-GINKO2
ExpressionInsectPromoterhsp70 promoterAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC4 CD
Plasmid#224251PurposeExpresses human KDAC4 (HDAC4) catalytic domain in E. coliDepositorInsertKDAC4 (HDAC4 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationOnly includes residues 648-1083 (catalytic domain…PromoterT5Available SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits