-
Plasmid#160956PurposeCenpf shRNA in pMKO.1 retroviral vectorDepositorInsertCenpf shRNA (Cenpf Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterU6Available sinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLOC-MCOLN1
Plasmid#131583PurposeFor expression of human MCOLN1 in mammalian cells, GFP-taggedDepositorInsertMCOLN1 (MCOLN1 Human)
UseLentiviralTagsturboGFP tagExpressionMammalianMutationPromoterCMVAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-COX8A
Plasmid#227309PurposeDonor template for mStayGold insertion into the C-terminus of the COX8A locus. For mitochondria visualization. To be co-transfected with sgRNAplasmid px330-PITCh-COX8A (Addgene #227308)DepositorInsertCOX8A Homology Arms flanking a mStayGold Tag (COX8A Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SK
Plasmid#136577PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, Klf4DepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KS
Plasmid#136617PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2DepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T2 gp78 CD-m1,2 / JM25
Plasmid#13307DepositorInsertgp78 (AMFR Human)
UseTagsGSTExpressionBacterialMutationcDNA corresponds to aa309-643 derived from human …PromoterAvailable sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet2_bGHpA
Plasmid#177352PurposeAAV expression of scFV-fused catalytic domain of TET2 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterCMV promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA Td2
Plasmid#176255PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi1-CASE
Plasmid#168120PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi1. Composed of the subunits G alpha i1 (GNAI1) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A121/E122 within GNAI1PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi3-CASE
Plasmid#168122PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi3. Composed of the subunits G alpha i3 (GNAI3) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A114/E115 within GNAI1PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVtet2_bGHpA
Plasmid#177353PurposeAAV expression of scFV-fused catalytic domain of TET2 from Synapisin promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…Promoterhuman Synapsine promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLZ12Km2-P23R:TA:Xen5
Plasmid#88902PurposeToxin-antitoxin stabilized bioluminescent reporter plasmid for Streptococcus expressionDepositorInserttoxin-antitoxin + LuxABCDE
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-N_SCAP:1-905
Plasmid#211228PurposeMammalian expression of full-length human SCAP isoform 2. N-terminal HiBiT tag.DepositorInsertSCAP:M1-D905 (SCAP Human)
UseTagsMVSGWRLFKKISGSSGGSSGExpressionMammalianMutationisoform 2. V798I natural variant (VAR_012203)PromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-C_SCAP:1-905
Plasmid#211302PurposeMammalian expression of full-length human SCAP isoform 2. C-terminal HiBiT tag.DepositorInsertSCAP:M1-D905 (SCAP Human)
UseTagsGSSGGSSGVSGWRLFKKISExpressionMammalianMutationisoform 2. V798I natural variant (VAR_012203)PromoterCMVAvailable sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-N_STRN:1-731
Plasmid#211230PurposeMammalian expression of full-length human STRN isoform 2. N-terminal HiBiT tag.DepositorInsertSTRN:M1-V731 (STRN Human)
UseTagsMVSGWRLFKKISGSSGGSSGExpressionMammalianMutationisoform 2PromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-C_WDR31:1-367
Plasmid#211326PurposeMammalian expression of full-length human WDR31 isoform 2. C-terminal HiBiT tag.DepositorInsertWDR31:M1-F367 (WDR31 Human)
UseTagsGSSGGSSGVSGWRLFKKISExpressionMammalianMutationisoform 2. 40-40: MissingPromoterCMVAvailable sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-C_STRN:1-731
Plasmid#211304PurposeMammalian expression of full-length human STRN isoform 2. C-terminal HiBiT tag.DepositorInsertSTRN:M1-V731 (STRN Human)
UseTagsGSSGGSSGVSGWRLFKKISExpressionMammalianMutationisoform 2PromoterCMVAvailable sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only