171,035 results
-
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-ER GFP
Plasmid#80069PurposeTo express and target GFP into the endoplasmic reticulum using lentivirusDepositorInsertER GFP (SEC61B Human)
UseLentiviralTagsGFP derived from Aequorea coerulescens on the NH2…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
luxB:cp157Venus+luxA/pRSETB Duet
Plasmid#197583PurposeBRET lux luciferase with cp157Venus for bacterial expressionDepositorInsertLuxA LuxBcp157Venus
UseE.coli expressionTagsHis X 6ExpressionBacterialPromoterT7Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PKC alpha WT
Plasmid#21232DepositorAvailable SinceAug. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA cyclin D1 HA T286A
Plasmid#11182DepositorInsertcyclin D1 T286A (CCND1 Human)
TagsHAExpressionMammalianMutationT286A. Mutant that cannot be degraded via the u…Available SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
human EB1 in pEGFP N1 to express EB1-GFP (JB131)
Plasmid#39299DepositorAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCH49 (crRNA expression vector)
Plasmid#217338PurposeCROP-seq crRNA expression vector with GFP and neo markerDepositorInsertAsDR-filler-AsDR8, GFP-neo
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA expression vector
Plasmid#51132PurposeFor in vitro transcription of sgRNA from the T7 promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterT7Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
mOrange-N1
Plasmid#54499PurposeLocalization: N1 Cloning Vector, Excitation: 548, Emission: 562DepositorTypeEmpty backboneTagsmOrangeExpressionMammalianAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC(F198Y)
Plasmid#234548Purposeto express a version with reduced constitutive activity (thanks to point mutation F198Y) of the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC(F198Y)
UseAAVMutationF198YPromotermGFAP(ABC1D)Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only