We narrowed to 10,496 results for: nar
-
Plasmid#109425PurposeExpresses human APOBEC3A containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A (APOBEC3A Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E/S302D
Plasmid#62531PurposeSerine 300 of Drosha is mutated to glutamic acid and serine 302 is mutated to aspartic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid and serine 302 changed to aspartic acid (DROSHA Human)
UseTagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acid and serine 3…PromoterAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1_CD
Plasmid#83571PurposeExpresses a mutant catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deleted, catalytic domain…PromoterCMVAvailable sinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBlue-ACTB-IR-IRES-Puro-pEF1α-EGFP-IR-ACTB
Plasmid#169921PurposeDNA donor plasmid for site-specific integration of IRES-Puro-pEF1a-EGFP cassette at the ACTB locus using Cas9-transposase fusion proteins.DepositorInsertIRES-Puro-pEF1a-EGFP
UseCRISPRTagsExpressionMutationPromoterEF1aAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-GST-eIF4E K119A
Plasmid#112818PurposeExpresses N-terminally GST-tagged mouse Eif4e K119A in bacterial cellsDepositorInsertEif4e (Eif4e Mouse)
UseTagsGSTExpressionBacterialMutationK119 mutated to A, increasing affinity for cap st…PromoterT7Available sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-B/c
Plasmid#199560PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stemDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseRNAiTagsExpressionMutationPromoter2x35SAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-N (LEU2)
Plasmid#177798PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterADH1Available sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-N (TRP1)
Plasmid#177797PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
UseTagsExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMS-dsRed2-WT LMNA-GFP minigene
Plasmid#128230PurposeLamin A splicing reporterDepositorInsertlamin A (LMNA Human)
UseTagsGFP and SV40-driven dsRed2 to identify transfecte…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLI
Plasmid#131228PurposeExpression of WT DNA polymerase iota with an N-terminal FLAG tag in mammalian cellsDepositorInsertDNA polymerase iota (POLI Human)
UseTagsFLAGExpressionMammalianMutationCoding sequence has been codon optimised for expr…PromoterCMV enhancer + CMV promoterAvailable sinceDec. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MultiMate 5 colors
Plasmid#206266PurposeExpression of 5 fluorescently labelled proteins in mammalian cells. Can be used as a CRE-donor (MultiBac system)DepositorInsertH2B (H. Sapiens), Actin and Tubulin (B. taurus), mito mCherry (Synthetic), CyOFP1 (E. quadricolor)
UseRecombinant baculovirus production, cre acceptor…TagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
JE301: pMVP (L5-L4) Tir1-P2A-AID
Plasmid#121722PurposepMVP L5-L4 entry plasmid, contains Tir1-P2A-AID for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Tir1 linked by P2A to AID domain fused to gene of interest.DepositorInsertosTir1-P2A-AID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc (C-term on osTIR1)ExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-tagBFP-HDR
Plasmid#163751PurposeHDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertSOX2 (SOX2 Human)
UseCRISPR and Synthetic BiologyTagsP2A-tagBFPExpressionMutationDoes not contain start codon to avoid random inte…PromoterAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-UAP56
Plasmid#157661PurposeExpresses UAP56 in E.coli cellDepositorInsertSpliceosome RNA helicase DDX39B (DDX39B Human)
UseTagsGST tagExpressionBacterialMutationdeleted amino acids 1-43PromoterAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
AsCas12a-2C-NLS in pCSDest
Plasmid#126637PurposeExpresses AsCas12a-2C-NLS in mammalian cellsDepositorInsertAsCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianMutationPromoterCMV IE94 promoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
Plasmid#109428PurposeA lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.DepositorInsertmCherry T2A GFP
UseLentiviralTagsExpressionMutationInserted 43 base pairs into mCherry to create rep…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-Tol2
Plasmid#113384Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseTol2 reporterTagsExpressionMutationPromoterAvailable sinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV EYFP Tubulin
Plasmid#206254PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes EYFP Tubulin under the control of CMV promoter.DepositorInsertEYFP Tubulin
UseMultimate/gateway entr 1TagsEYFPExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 CMV mito mCherry
Plasmid#206256PurposeENTR Vector 3 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mitochondrially localised mCherry under the control of CMV promoter.DepositorInsertmito mCherry
UseMultimate/gateway entr 3TagsCOX8 mitochondrial tagExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-luciferase
Plasmid#113353Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-122 target sites
Plasmid#120298PurposeAAV vector for expression of AcrIIA4 with two miR-122 binding sitesDepositorInsertAcrIIA4-2xmiR-122 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1
Plasmid#83569PurposeExpresses TET1 with a mutated catalytic domain in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationcatalytic domain mutant H1672D, D1674APromoterCMVAvailable sinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cdt1 human
Plasmid#72681Purposemammalian expression of human Cdt1DepositorInsertCdt1 (CDT1 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2: Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos-Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1679)
Plasmid#160619PurposeModule for estradiol-inducible expression of the PhiC31 integrase gene and dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertERLexABDGal4AD / PhiC31 / GRLacIBDGal4AD / RDF
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only