We narrowed to 2,340 results for: CO
-
Plasmid#246073PurposeBacterial expression of ECOR31 2TMbeta residues 72-200 with N-terminal His-SUMO tag and co-expression of ECOR31 mCpolDepositorInsert2TMbeta
ExpressionBacterialAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-HOT-mNeon-Stop-PGK-mCherry-CAAX
Plasmid#240800PurposeCRISPR-HOT donor plasmid for mNeonGreen fusion protein co-expressing membrane-bound mCherry via PGK promoterDepositorInsertmNeonGreen mCherry-CAAX
UseCRISPRExpressionMammalianMutationnonePromoterPGKAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG_ATG101
Plasmid#223796PurposeExpression of recombinant protein for purification (co-expression with ATG13)DepositorInsertATG101 (ATG101 Human)
ExpressionMammalianAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 CARD8 Ub-S297
Plasmid#169965PurposepDONR221 for Gateway shuttling. Contains the CARD8 C-terminus fused to ubiquitin (co-translationally processed)DepositorAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-ORF24-3xFLAG
Plasmid#138423PurposeExpresses full-length ORF24 with a C-terminal 3xFLAG tag in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT2-4xUAS:P2A-EGFP
Plasmid#127591PurposeThis vector is used for cloning a gene driven by 4xnrUAS, to be co-expressed with EGFP through P2A self-cleaving peptides.DepositorTypeEmpty backboneUseZebrafish expressionExpressionMammalianAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_PKA-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233371PurposeEF1α driven co-expression of the PKA activity recorder Kinprola_PKA fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_PKA-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCh-LgBiT-2A-EGFP-Vin-PILATeS
Plasmid#216761PurposePiggyBac vector for stable co-expression of mCherry-LgBiT and EGFP-Vinculin-PILATeS (700 pM) in mammalian cells. Requires transposaseDepositorInsertmCherry-LgBiT-P2A-T2A-EGFP-Vin-PILATeS
TagsEGFP and mCherryExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMZ7
Plasmid#223180PurposepORI28 derivative with lacZ and upp gene inserted into the backbone; for generating gene-specific knockouts.DepositorTypeEmpty backboneUseChromosomal integrationAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W
Plasmid#163178PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
IFITM3-N21del-V93-TAG
Plasmid#122480Purposeexpresses human IFITM3-N21del with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
ExpressionMammalianMutationChanged Valine 93 to amber codon and deleted amin…Available SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-7 in pcDNAI/Amp
Plasmid#54473PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-7. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-7 (GNG7 Aequorea victoria, Human)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Aequorea victoria, Human)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-KORD-P2A-3xHA-hM3D(Gq)
Plasmid#220611PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and 3x HA-tagged excitatory hM3D(Gq) DREADD receptor.DepositorInsertFLAG-KORD-P2A-3x HA-hM3D(Gq)
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBT2-4xUAS:P2A-mCerulean3
Plasmid#127592PurposeThis vector is used for cloning a gene driven by 4xnrUAS, to be co-expressed with mCerulean3 through P2A self-cleaving peptides.DepositorTypeEmpty backboneUseZebrafish expressionAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv4
Plasmid#221432PurposeLentiviral CRISPR/Cas9 vector for co-expression of sgRNAs and Cas9 protein.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-3xFlag/nsp7-His6-nsp8 (SARS-CoV-2)
Plasmid#169183PurposeBaculoviral transfer vector to co-express nsp12-3xFlag and nsp7-His6-nsp8 fusion in insect cellsDepositorInsertnsp12-3xFlag/nsp7-His6-nsp8 (ORF1ab SARS-CoV-2)
Tags3xFlag (nsp12 C-terminus) and His6 (as internal t…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIRC5-Split PS Intein-N tTA
Plasmid#242033PurposeN-terminal segment of the blue-light-controlled split PS Intein tTA gene expression system, co-expressing mTagBFP2 under the BIRC5 promoter.DepositorInsertSplit PS Intein-N tTA
TagsmTagBFP2ExpressionMammalianMutationThe CMV promoter was replaced with the BIRC5 prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
phTERT-Split PS Intein-N tTA
Plasmid#242034PurposeN-terminal segment of the blue-light-controlled split PS Intein tTA gene expression system, co-expressing mTagBFP2 under the hTERT promoter.DepositorInsertSplit PS Intein-N tTA
TagsmTagBFP2ExpressionMammalianMutationThe CMV promoter was replaced with the hTERT prom…PromoterhTERTAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only