We narrowed to 10,599 results for: cat.1
-
Plasmid#192956PurposeFor membrane insertion study; Expresses tse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1300)
UseTagsExpressionBacterialMutationencodes for tse5 (1169-1300)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1317)
Plasmid#192957PurposeFor membrane insertion study; Expresses tse5-CT (1169-1317) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1317)
UseTagsExpressionBacterialMutationencodes for tse5 (1169-1317)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1269)
Plasmid#192954PurposeFor membrane insertion study; Expresses tse5-CT (1169-1269) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1269)
UseTagsExpressionBacterialMutationencodes for tse5 (1169-1269)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS238D1::sptse5-CT_phoA-lacZalpha
Plasmid#192961PurposeTest the biological function of the spTse5-CT (1169-1317)-PhoA (22-474)-LacZ (4-60) fusion protein in P. putidaDepositorInsertsptse5-CT_phoA-lacZ_
UseTagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1317) fused to phoA-lacZal…PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1229)
Plasmid#192953PurposeFor membrane insertion study; Expresses tse5-CT (1169-1229) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1229)
UseTagsExpressionBacterialMutationencodes for tse5 (1169-1229)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1281)
Plasmid#192950PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1281)
UseTagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1281)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1269)
Plasmid#192949PurposeFor membrane insertion study; Expresses Tse5-CT (1169-1269)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1269)
UseTagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1269)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1300)
Plasmid#192951PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1300)
UseTagsPelB signal peptideExpressionBacterialMutationencodes for sptse5 (1169-1300)PromoterAvailable sinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-MUM2sp-Citrine-ADPG2
Plasmid#170725PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the Citrine and the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)DepositorInsertARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 (PGAZAT Mustard Weed)
UseGateway donor vector / entry cloneTagsCitrine tag (714bp)ExpressionMutationPromoterAvailable sinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMB-KO, S199AzF)-HIS
Plasmid#153445PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode B knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
UseTags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable sinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG-WPRE
Plasmid#127869PurposepAAV plasmid expressing an NOS-IN133.3xFLAG fusion protein under the hSyn promoterDepositorInsertNos1 (Nos1 Mouse)
UseAAVTags3xFLAGExpressionMutationAmino acids 1-133 onlyPromoterhSynAvailable sinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-E988K
Plasmid#173945PurposeBacterial expression of inactive PARP1 mutant (E988K attenuates catalytic and PAR-branching activity of PARP1)DepositorInsertPARP1-E988K (PARP1 Human)
UseTags6xHisExpressionBacterialMutationV762A, E988KPromoterAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF1508
Plasmid#143817PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertMTF1 (MTF1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0271
Plasmid#142505PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertTCF7 (TCF7 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0270
Plasmid#142504PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertTCF7 (TCF7 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0272
Plasmid#142506PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertTCF7 (TCF7 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
ins:GCaMP6s; cryaa:RFP
Plasmid#110285PurposeA zebrafish insulin promoter driving the calcium indicator, GCaMP6s. Contains red eye marker, and is flanked with I-SceI sites.DepositorInsertGCaMP6s
UseZebrafishTagsExpressionMutationPromoterinsulinAvailable sinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorInserthuman AMPK alpha 1 exon1 gRNA (PRKAA1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorInserthuman AMPK alpha 1 exon1 gRNA (PRKAA1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-Fc-His
Plasmid#72136PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-Fc-His
Plasmid#72138PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF2564
Plasmid#142327PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF655 (ZNF655 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T Doc2beta C2AB(125) G361C
Plasmid#134694PurposeEncodes cytoplasmic domain of Doc2beta for bacterial expression, purification, and labelingDepositorInsertDouble C2 protein beta (Doc2b Rat)
UseTagsGSTExpressionBacterialMutationG361C, C145A, C217A, C249A, C290A, C338A, C387APromoterAvailable sinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del13)-AP-His
Plasmid#72011PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 13), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF2189
Plasmid#141961PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF410 (ZNF410 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-W318R
Plasmid#174793PurposeBacterial expression of an inactive PARP1 (W318R disrupts interdomain communication and HD subdomain unfolding)DepositorInsertPARP1-W318R (PARP1 Human)
UseTags6xHisExpressionBacterialMutationW318, V762APromoterAvailable sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-AP-His
Plasmid#72010PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-AP-His
Plasmid#72012PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
SL534
Plasmid#49940PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD RH-1 (RHOXF2 Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del13)-Fc-His
Plasmid#72137PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 13), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF2604
Plasmid#144049PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF470 (ZNF470 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF1097
Plasmid#143761PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertHSFX1 (HSFX1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2562
Plasmid#144044PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF655 (ZNF655 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2188
Plasmid#143350PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF410 (ZNF410 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2190
Plasmid#143351PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF410 (ZNF410 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1342
Plasmid#142377PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertPOU5F2 (POU5F2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2565
Plasmid#144131PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF655 (ZNF655 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1417
Plasmid#143269PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertZNF214 (ZNF214 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2250
Plasmid#141991PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertTCF19 (TCF19 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only