We narrowed to 1,982 results for: rigi
-
Plasmid#110974PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_0511400 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1333300-COMP-blac-flag-his
Plasmid#110972PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInserttransmembrane protein Tmp21 homologue, putative (PF3D7_1333300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1462300-COMP-blac-flag-his
Plasmid#110970PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_1462300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1352500-COMP-blac-flag-his
Plasmid#110969PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertthioredoxin-related protein, putative (PF3D7_1352500 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0912400-COMP-blac-flag-his
Plasmid#110966PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertalkaline phosphatase, putative (PF3D7_0912400 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIESP15-COMP-blac-flag-his
Plasmid#110958PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertparasite-infected erythrocyte surface protein (PIESP15) (PF3D7_0103900 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1105300-COMP-blac-flag-his
Plasmid#110960PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein, unknown function (PF3D7_1105300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#108274PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-SOX2-p2a-KLF4
Plasmid#193292Purposeepisomal hSK (expressing human SOX2 + KLF4)DepositorExpressionMammalianMutationF2A of original pCXLE-SK vector was replaced with…PromoterCAGAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBFC1207
Plasmid#186694PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, GmR+sfGFP cargo, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_2xBsaI_NT (Guide Stuffer) crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS426-HsFECH
Plasmid#174524PurposeExpresses human ferrochelatase (FECH) in yeastDepositorInsertFECH with yeast HEM15 promoter and terminator (FECH Human, Budding Yeast, Synthetic)
ExpressionYeastMutationLacks original mitochondrial targeting sequence (…PromoterHEM15 (yeast, 257 bp)Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
Plasmid#115890PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115893PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α promoter (1.1kb short version)Available SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR A757
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only