...about the role of methylation (Hrit et al. 2018, Kaas et al. 2013). Figure 2: CRISPR TET-based...CRISPR-based approach for targeted DNA demethylation. Cell Discov 2, 16009. https://doi.org/10.1038/celldisc...cause demethylation?  Dividing cells depend on DNA methyltransferase 1 (DNMT1) to copy methylation marks... proteins are not demethylases; they are dioxygenases that oxidize 5-methylcytosine to create rare DNA...complete DNA demethylation can be achieved by dCas9 alone, without TET (or any demethylase) fusion. This...site. So, when DNMT1 methylates the genome during DNA replication, it doesn’t methylate sites blocked by ...the original methylated strand is diluted to undetectable amounts: ergo, DNA demethylation! With optimization...

...as depicted in Lane 2. Controlling methylation Finally, you can control methylation by altering your choice... Dcm methylase adds a methyl group to the second cytosine of CCWGG EcoKI methylase adds a methyl group...contain 3 methylases that recognize and methylate different stretches of DNA: Dam methylase adds a methyl...information. Enzyme Dam methylation Dcm methylation EcoKI methylation ApaI Not affected Blocked ...questions is the same--methylation! Read on to learn about how DNA methylation may affect your restriction...The other component of these systems, methyltransferases, methylate DNA at particular sequences to prevent...restriction modification systems containing methyltransferases that add methyl groups to specific DNA sequences ...

...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...PTHR1 PTH2 parathyroid hormone 2 TIP39 PTH2R parathyroid hormone 2 receptor PTHR2 PTHLH parathyroid hormone-like...

...page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 nucleocapsid protein...protein. SARS-CoV-2 Plasmids : Plasmids that are available or coming soon containing SARS-CoV-2 sequences. SARS-CoV... targeting the SARS-CoV-2 nucleocapsid protein (Brian Geiss). Anti-SARS-CoV-2 Nucleocapsid Protein [mBG86...targeting the SARS-CoV-2 nucleocapsid protein (Brian Geiss). Plasmids SARS-CoV-2 Plasmids Many plasmids...SARS-CoV-2 plasmids are curated on a separate Ginkgo Bioworks Plasmid Collection page. SARS-CoV-2 Pooled...Converting Enzyme 2) is the host cell receptor mediating the entry of SARS-CoV and SARS-CoV-2 viruses. ( 1 ...that primes the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 2 ) FURIN - an enzyme that...

...FHF2 Human Mouse IgG2a 114527 Anti-JIP-2/IB-2 [N135/37.2R] JIP-2/IB-2 Mouse Mouse IgG2a 114529 Anti-Pan-SAPAP...Anti-CDY1/2/L1/L2 [N143/36R] CDY1/2/L1/L2 Human Mouse IgG2a 206535 Anti-CDY1/2 [N143/38R] CDY1/2 Human Mouse...206763 Neuroligin-2 scFv [L107/90] L107/90 scFv Neuroligin-2 Mouse Mouse 206764 Neuroligin-2 scFv [L107/95...receptor Rat Mouse IgG2a 114484 Anti-Stonin-2 [N346/9R] Stonin-2 Human Mouse IgG2a 114485 Anti-NSD3 [N348...Pan-FHF-A Human Mouse IgG2a 114510 Anti-REEP1/2 [N326D/29R] REEP1/2 Mouse Mouse IgG2a 114511 Anti-Kv3.1b K+ ...Mouse Mouse IgG2a 114547 Anti-Mitofusin-2 [N171/17.4R] Mitofusin-2 Mouse Mouse IgG2a 114548 Anti-Mortalin...Mouse IgG2a 140065 Anti-SCG10/Stathmin-2 [L5/1R] SCG10/Stathmin-2 Rat Mouse IgG2a 140066 Anti-Co-Rest/RCOR1...

...Neurofibromin 1 NFE2L2 Nuclear factor, erythroid 2 like 2 NFKB1 Nuclear factor of kappa light polypeptide...factor receptor bound protein 2 ICMT Isoprenylcysteine carboxyl methyltransferase INSR Insulin receptor INSRR...ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 CCND CCND1 CCND2 CCND3 Cyclin D CDK CDK4 CDK6 Cyclin-dependent...enhancer of kinase suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity...transcription factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor EIF4EBP EIF4EBP1...binding protein ERBB2 Erb-b2 receptor tyrosine kinase 2 ERK MAPK1 MAPK3 Also known as MAPK; Mitogen-activated...3,4,5-trisphosphate-dependent Rac exchange factor 2 PRKA PRKAA1 PRKAA2 PRKAB1 PRKAB2 PRKAG1 PRKAG2 PRKAG3...

...48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Peter...Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73546 pEvol-pAzFRS.2.t1 pAzFRS.2.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial..._AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Simon...Jesse Rinehart 71403 pCMV-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial,...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...pDule2-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...

...of basal H 2 O 2 levels with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with...Belousov Hydrogen Peroxide (H 2 O 2 ) Cytosolic or mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) ...peroxiredoxin-2-based probe. Nat Commun. 2018 Aug 7;9(1):3145. Hadley Sikes Hydrogen Peroxide (H 2 O 2 ) Monitoring...encoded Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi...Calcium Red fluorescent calcium sensors (fRCaMP1/2, GECO1/2) The kinetic mechanisms of fast-decay red-fluorescent...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET ... eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn(2+) Imaging...

...TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA DLK1 (site #2) TAL3422 & TAL3423 TGAGGTACAGGCAGCTGGtggcgcagcagagggagcTGATCCAGGACCAGGCCA...TGGAAGACCCGTTGGAGAaagagatcccaccaacTGAAATAAAAGATTCAGA hemogen (site #2) TAL3276 & TAL3277 TGATTTGTTTGTTTGCTaggaggaattcggcggCGACTCAGAGACAGAGA...TGTTTCAGCAGAGCCCCGctgaagagctccccatGGAGATGGAAGGAGTGGA hif1al (site #2) TAL3280 & TAL3281 TGCCCTCAGGACTTCTGCacgcctgaactccgcaAGCTTCTGTCTCCAATA...TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA park2 (site #2) TAL3334 & TAL3335 TGATCGTTTTCGTGCGGTttaattccagccatggGTTCCCGGTGGAGTTGGA...TGTTAAGGCTCTGTATAGcagtgtgtgtcctggcCACTTGCTGGGCTCAGGA retinitis pigmentosa 2 (X-linked recessive) TAL3526 & TAL3527 TCTTTTTGTGCTGCGCCAcccagcccataatcgaGTCTTCTACAGGCATGAA...TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA Sox2 (site #2) TAL3368 & TAL3369 TGGTGGGGTAGACTTTCGagaaaatcggtttaaaTGTATAACATGATGGAAA...TGCTTTCACGCATTGCACtacacattggcaagatgGCAGCCACCATCGGGAGA prothymosin alpha a TAL3344 & TAL3345 TTATCATTCGCATCTCGTatttctctttatattaTTTTATTCCGAGACCCCA...

...disease-causing mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an...mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens...PMID: 16905679 Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated ...Neul et al. 2008. Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome...phenotypes of males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet...is not clear, however, the ability to bind to methylated DNA and recruit known co-repressors or other ...including: the N - t erminal D omain (NTD) the M ethyl B inding D omain (MBD) a T ranscriptional R epressor...

...New and Noteworthy: Use tau constructs to study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...guide to using plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein...system, vesicular brain cells and more. New and Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep ...and fibroblasts into neurons and more. New and Noteworthy: Study aberrant axon initial segment (AIS) plasticity...

...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...

...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID...Complex Symbol Name AKT AKT1 AKT2 AKT3 v-akt murine thymoma viral oncogene homolog FOXO Forkhead box O GBL/...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...including histone acetylation/demethylation, and cytosine methylation/demethylation. CRISPR...p300 histone demethylation by LSD1 cytosine methylation by DNMT3A or MQ1 cytosine demethylation by Tet1 These...

...left free to interact with the target DNA. Figure 2: Overview of the NHEJ repair mechanism Cas9 will only...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...

...par with ZF arrays, if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove...variety of backbones in just a few steps ( Figure 2 ). The Bogdanove group also hosts web-based software...mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53. PMID: 21248753 . TALEs for the masses. Rusk...targets cytosine, NI targets adenenine, NG targets thymine, and NN targets guanine (though NN can also bind...

...Layer 2-3_IT Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT ..., Sunkin SM, Smith KA, Esposito L, Waters J, Thyagarajan B, Yao S, Lein ES, Zeng H, Levi BP, Ngai J, Ting...

...SARS-CoV-2 spike pseudotyping, visit the SARS-CoV-2 Pseudotyped Virus collection page. SARS-CoV-2 detection...of SARS-CoV-2 entry and become upregulated during viral infection.  Expression of SARS-CoV-2 viral proteins...labs in over 75 countries. Figure 1: SARS-CoV-2 proteins and other components. Image from Maya Kostman... protein, variants, and pseudotyping The SARS-CoV-2 virus depends on its spike protein to bind ACE2, the...of infection and how to interfere with it in a BSL-2 lab instead of a BSL-3 lab. Jesse Bloom’s lab published...reagents for pseudotyping lentivirus with the SARS-CoV-2 spike protein. They deposited the plasmids used for...individuals are at neutralizing the different SARS-CoV-2 spike variants. You can learn more about their research...

...same site, is 2’-fluoro (2’-F), which substitutes a fluorine for the hydroxyl group at the 2’ position. ...most common of these is 2’-O-methylation, where a methyl group is added to the 2’ hydroxyl group of the...together, for example phosphorothioates with 2’-O-methyl modifications, proved more stability than just...generated by introduction of a single photocleavable 2-nitrobenzyl linker in the 20-bp targeting region of...linkages, unlocked nucleic acids, and a constrained ethyl.  Can’t decide which RNA backbone modification is...similar advantages, bridged nucleic acids with N-methyl substitutions are slightly more efficient and less...

...for the 2+ million DHS sites. See below for further details. DNA is a 3D Fractal Figure 2: DNA compaction...: 1. Find Enhancers that have NANOG binding sites 2. Design a CRISPR screen to target and disrupt the ...NANOG enhancers 3. CRISPR out the enhancers from step 2. See which ESCs die or differentiate Step 3 reveals...expression for NANOG enhancers, we’re ready for step 2: design a CRISPR screen to disrupt these enhancers...to CRISPR out the enhancers we identified in step 2. The result is a heterogenous population of stem cells... region that has mono-methylated and acetylated histones, but not tri-methylated histones, functions as...denote enhancers as follows: (mono_methylation + acetylation) - tri_methylation In the next section we’ll ...

...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227... The first base editors converted cytidine to thymidine; newly engineering base editors convert adenosine...

...8661 p4455 FLAG-hPLIC-2 UBQLN2 Flag CMV ALS Peter Howley 8662 p4456 FLAG-hPLIC-2 NTF UBQLN2 Flag CMV ALS...196208 GB1-A11(2-196)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196209 GB1-A11(2-196, G38R)-Strep...196210 GB1-A11(2-196, D40G)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196211 GB1-A11(2-196, G175R...196212 GB1-A11(2-196, G189E)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196213 GB1-A11(2-52)-Strep ...TLS 1: hTLS.pBSKS(+) FUS T7 ALS David Ron 21828 TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS 3: TLS.pRSET.C...ApoE Alzheimer's Sohail Tavazoie 51436 pGL3Basic-ME.2/ApoEpromoter APOE ApoE Alzheimer's Sohail Tavazoie...T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His T7 ALS Nicolas Fawzi 127196 pJ411 FUS 1-163...

.... Diagnostic restriction digests are comprised of 2 separate steps: 1) incubating your DNA with restriction...which cleave the DNA molecules at specific sites and 2) running the reaction on an agarose gel to determine...including a 1.2 kb insert. The plasmid was digested with 2 unique enzymes (HindIII and BamHI) and run on an agarose...to serve as a reference band. The uncut DNA (lane 2) shows 3 possible plasmid conformations, with relaxed...Watch out for methylation issues. Enzymes like XbaI and ClaI are sensitive to methylation and their activity...will need to purify your DNA from a dcm or dam methylation-deficient bacterial strain such as JM110 or INV110...

...//doi.org/10.1002/1096-8628(200022)97:2<147::aid-ajmg6>3.0.co;2-o Baker SA, Chen L, Wilkins AD, Yu P, ...Syndrome? Caused by a mutation in the methyl-CpG binding protein 2 (MECP2) gene, Rett Syndrome is a rare...mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet 23:185–188 . https://doi.... RE, Zoghbi HY (2000) Rett syndrome: Methyl-CpG-binding protein 2 mutations and phenotype-genotype correlations...et al., 1999). We now know that MECP2 binds to methylated CpG dinucleotides and CAC trinucleotides during...

...of conventional gene targeting is lowered to about 2-3 months. But certain models remain more difficult...included in the final ssDNA template. Figure 2: Overview of ivTRT to generate an ssDNA repair template... floxed conditional allele requires you to target 2 loxP sites to intronic regions 0.5 - 0.8 kb apart....Typically, Easi-CRISPR works best with insertions of 2 kb or less. Luckily, most of the commonly used cassettes... induction systems (ttA or rtTA) are between 1 to 2 kb in length. There are plenty of Addgene plasmid ...create the ssDNA construct as described in Figure 2.  You can also use Addgene plasmids to purify Cas9...directed repair. Using long ssDNA donors, the Gurumurthy and Ohtsuka groups have obtained an average knock-in...

... to the lysosome where they are finally degraded (2, 3). Once you've created your fusion protein, it's...examples include the ImageJ plugins JACoP and Coloc 2, BioImageXD, and customized CellProfiler pipelines...colocalization analysis example is given in Figure 2 (adapted from 4) - Dunn et al. 2011 provides an in-depth...Since colocalization relies upon the detection of 2 independent fluorescent signals and their potential...here! References 1. Allen Institute Plasmid Pages 2. Cooper GM. 2000. The Cell: A Molecular Approach. ... in protein localization and transport between healthy and diseased states can also provide interesting... the function of your protein of interest in a healthy or diseased cell. We hope you find the resources...

...repository of tools for SAR-CoV-2 research. Two new antibodies, Anti-SARS-CoV-2 Nucleocapsid Protein [mBG17...Anti-SARS-CoV-2 Nucleocapsid Protein [mBG86], target distinct epitopes on the SARS-CoV-2 nucelocapsid ...Anti-SARS-CoV-2 Antibodies here! Terry, J.S., et al. (2021). Development of a SARS-CoV-2 nucleocapsid ...prime editor PE7 Antibodies to facilitate SARS-CoV-2 research New viral vector preps of Voltron2 voltage... incorporates La’s N-terminal domain, PE7 (Figure 2).  PE7 shows enhanced editing efficiencies in a number...editor. Find PE7 plasmids here!     Figure 2: PE7 improves prime editing. A) Schematic of PE7 prime...PMID: 38570691. Antibodies to facilitate SARS-CoV-2 research   By Ashley Waldron Ready-to-use recombinant...

...Citorik Plasmids here). In both cases, they used 1-2 CRISPR crRNAs targeting sequences found only in certain...resensitize antibiotic-resistant bacteria (Figure 2). The first phage introduced is lysogenic, integrating...machinery targeting 1) the given resistance gene and 2) a second lytic phage. Bacteria that receive this ...bacteria have previously flourished.   Figure 2: Two-phage strategies to resensitize bacteria to antibiotics...237163. Find plasmids from this paper at Addgene. 2. Bikard, David, et al. “Exploiting CRISPR-Cas nucleases...References 1. Citorik, Robert J., Mimee, Mark, and Timothy K. Lu. “Sequence-specific antimicrobials using ... Hiroki, Sebastien Lemire, Diana P. Pires, and Timothy K. Lu. “Engineering Modular Viral Scaffolds for...

...Cre-ERT2 CAG Mammalian Heller 112622 pVHC_PGKneoLox2DTA.2 Venus, Cre-ERT2, targeting vector with MCS for homology...homology arms Mammalian Heller 112623 pEHC_PGKneoLox2DTA.2 Emerald, Cre-ERT2, targeting vector with MCS for homology... arms Mammalian Heller 112624 pmTHC_PGKneoLox2DTA.2 TFP, Cre-ERT2, targeting vector with MCS for homology...arms Mammalian Heller 112625 ptdTHC_PGKneoLox2DTA.2 tdTomato, Cre-ERT2, targeting vector with MCS for ...25;1504(4):467-86. doi:10.1016/0022-2836(81)90375-2. PubMed . Ventura A, Meissner A, Jaenisch R, Jacks...Cre CAG Mammalian Pelczar 51276 Thy1.2-Roxed-Cre Dre-respondent Cre Thy1 Mammalian Pelczar 51507 AAV pmSyn1...

...plasmid-based expression requires serial transfection of 1 or 2 plasmids that express the reprogramming factors of...for generating iPSCs by plasmid transfection where 2 of 11 clones tested had plasmid integration. Another...understanding the mechanisms of reprogramming, and 2) studies with clinical endpoints. In the first scenario...PubMed PMID: 27764162. PubMed Central PMCID: 5072705. 2. Sommer, Cesar A., and Gustavo Mostoslavsky. "The ...challenges." Journal of Cellular Physiology 228, no. 2 (2012): 267-75. PubMed PMID: 22767332.  3. Kim, Dohoon...PubMed PMID: 23546745. PubMed Central PMCID: 4176696. 2. Yusa, Kosuke, Roland Rad, Junji Takeda, and Allan...generation. Expert opinion on biological therapy, 10 2, 231-42. PubMed PMID: 20088717. PubMed Central PMCID...

...host range plasmids. FEMS Microbiology Letters, 348(2), 87–96. https://doi.org/10.1111/1574-6968.12241  ...mobilization of broad host-range IncQ plasmids. Plasmid, 62(2), 57–70. https://doi.org/10.1016/j.plasmid.2009.05.001...negative hosts. Biotechnology and Bioengineering, 106(2), 326–332. https://doi.org/10.1002/bit.22695  Schmidhauser...Legionella pneumophila, Methylophilus methyltrophus, Methylococcus methanolicus, Methylosinus trichosporium, Myxococcus...Klebsiella aerogenes, K. pneumoniae, Methylophilus methylotrophus, Moraxella spp., Mycobacterium aurum...Klebsiella spp., Legionella pneumophila, Methylophilus methylotrophus, Myxococcus virescens, M. xanthus, Proteus...eutrophus, Azotobacter vinelandii, Brevibacterium methylicum, Caulobacter crescentus, Desulfovibrio vulgaris...

...Table 2: Lab strains of E. coli Strain Natural resistance Primary Use Genotype ccdB Survival 2 T1R ...resistance to tetracycline Additionally, Table 2 provides a quick reference for some of the popular... mk+) Unmethylated DNA not degraded, cell still can methylate DNA   hsdS(rk-,mk-) Unmethylated DNA not...Consequence dam DNA adenine methylase mutation (GATC) Preparing unmethylated DNA, important when trying... XbaI) dcm DNA cytosine methylase mutation (CCWGG) Preparing unmethylated DNA, important when trying...pathway that cleaves methylated cytosine DNA Allows for uptake of foreign (methylated) DNA mrr, Δ(mcrC-mrr...that cleaves methylated adenine or cytosine DNA Allows for uptake of foreign (methylated) DNA recA, ...

...Figure 2: dCas9-Tet1 demethylates cytosines at promoters and enhancers. This targeted demethylation is associated...CRISPR-based approach for targeted DNA demethylation. Cell Discovery 2: . https://doi.org/10.1038/celldisc...pX330a dCas9-LSD1 for targeted removal of H3K4me1/2 and H3K9me2 histone modifications. Like the TALE-LSD1...fused a TALEN to the Tet1 demethylase catalytic domain, could mediate demethylation and induce transcription... fused a TAL effector to LSD1 histone demethylase to demethylate enhancer regions (Mendenhall et al., ...Tet1 demethylase Ronggui Hu’s lab has created pdCas9-Tet1-CD for targeted cytosine demethylation in mammalian... dCas9-DNMT3A methylates cytosines at promoters and enhancers. This targeted methylation is associated...

... the two DNA strands and releasing topoisomerase (2).  These days commercially available TOPO kits provide...Taq polymerase using your favorite PCR protocol.  2. Set Up TOPO Cloning Reaction: Mix together the PCR...PubMed PMID: 1658796. PubMed Central PMCID: PMC52876. 2. Novel approach to molecular cloning and polynucleotide...ability of complementary basepairs adenine (A) and thymine (T) to hybridize and form hydrogen bonds. This ...vectors or cloning arms with overhanging 3´ deoxythymidine (T) residues that are covalently linked to ...

...Carballosa, et al, (2015) eNeuro, March/April 2015, 2(2) e0001-15.2015. Pubmed. Resources: http://openspim.org...orthogonal-plane fluorescence optical sectioning (OPFOS) (2). Arne Voie, David Burns and Francis Spelman focused...in LSFM. In LSFM the laser light sheet, typically 2-6  microns, illuminates only one thin plane of the...(10).  He used a solution of benzyl alcohol and methyl salicylate which was later modified by others to...subpopulation of neurons are brightly labeled with GFP (e.g. Thy1-YFP-H mice).  However, we recently developed AAV...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...PAM site. Uridine is subsequently converted to thymidine through base excision repair, creating a C to ...

...the addition of Cre recombinase (Figure 2). Figure 2: A knockout targeting vector designed to... through an experiment designed to knock out exon 2 of a given gene.   Figure 1: A knockout targeting...For recombination to occur in a cell, a minimum of 2 kb of sequence homology is required, but 6 to 14 kb...construct to your target cells. After recombination, exon 2 of the targeted gene will be removed from the chromosome...the GFP/NeoR cassette is inserted in place of exon 2. Thus, the targeted gene is disrupted (knocked out...recombination event will remove NeoR only and leave exon 2 floxed, as seen in line 4 of Figure 4. Since the loxP...genome, a negative selection marker like the HSV thymidine kinase (HSV-tk) is included just outside one of...

... constructed 2 versions of this reporter to target the K9 (pcDNA3-K9 histone methylation reporter) and... 525.7570 (2015): 533-537. PubMed PMID: 26352475. 2. Bygren, Lars O., et al. "Change in paternal grandmothers...in their DNA methylation patterns, either large increases or decreases. Hypermethylation of CpG islands...hybridization, methylation-sensitive restriction enzyme digestion, DNA adenine methyltransferase identification...linker is a methyllysine binding domain (chromodomain), which binds selectively to lysine-methylated peptides...the results. When methylation occurs at the histone-derived peptide, the methyllysine binding domain causes...to recognise lysine 27 methylation. When tested in living cells where methylation of these sites was controlled...

...generate 2 possible products: 1) a partially dsDNA duplex with single-stranded 3’ overhangs or 2) if the...recombineering system has three components (Figure 1): 1) Exo, 2) Beta, and 3) Gam. All three are required for recombineering...generic lambda red recombineering experiment (Figure 2). In the following sections, key steps that differ...confirmation of recombinant clones.    Figure 2: Overview of using Lambda Red recombineering system...pairs of homology to the targeted insert site (Figure 2, top).  These primers are typically ~70 nucleotides...bacteria that has key MMR proteins knocked out or 2) specially design ssDNA oligos to avoid MMR: 1) E....will have more unintended changes to their genomes. 2) Designing ssDNA oligos that avoid MMR activation:...

...digital PCR. Human Gene Therapy Methods, 25(2), Article 2. https://doi.org/10.1089/hgtb.2013.131 Lock,... virus Once you have transfected your cells, wait 2–5 days and then collect the supernatant and/or producer...quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Human ..., R., & Kleinschmidt, J. (1999). Titration of AAV-2 particles via a novel capsid ELISA: Packaging of genomes... genomes can limit production of recombinant AAV-2. Gene Therapy, 6(7), Article 7. https://doi.org/10.1038...Characterization of a recombinant adeno-associated virus type 2 Reference Standard Material. Human Gene Therapy, 21...rAAV from your supernatant, you can simply use polyethylene glycol (PEG). We add 25 mL of 40% PEG solution...