Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 303 results for: hal.2

Showing: 1 - 40 of 303 results

  1. Countdown to Halloween @Addgene

    Type
    Blog Post
    ...Halloween is only 2 days away and here at Addgene we couldn’t be more excited! As a small, tight-knit...things: fun, teamwork, and competition. And our Halloween celebration this Friday will combine all of these...these. Addgenies have been organizing Halloween festivities for years – searching our photo archives I...destroyed to protect the innocent revelers. Our Halloween costume contests have become an annual tradition...colleagues. Success is sweet – as sweet as all that Halloween candy you’ll gorge yourself on in the coming days...Hopefully, I’ve made clear how excited we get for Halloween and how seriously we take costume design. In case...continue to have an amazing turnout for the annual Halloween costume, so I expect some great costumes this ...

  2. Six Spooky Science Stories and Halloween at Addgene

    Type
    Blog Post
    ...melanogaster." Molecular and cellular endocrinology 215.1-2 (2004): 1-10. PubMed PMID: 15026169. Soo, Rochelle...another snail, completing its lifecycle. Halloween genes The Halloween genes are a set of cytochrome P450 genes...incorporate science themes into our fun activities and Halloween is no exception. For the past 10+ years, Addgenies...ping pong table. This year, in addition to the Halloween contest, we’ve also carved pumpkins (yes, Blugene...melanogaster (Gilbert, 2004). Mutations in these genes are lethal, associated with defective exoskeleton formations...1983.3 (1983): 813-816. Gilbert, Lawrence I. "Halloween genes encode P450 enzymes that mediate steroid...company culture at Addgene See some of our previous Halloween costume contests ...

  4. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ...inspire and open a new conversation about GMOs.  Challenge #2: Technical obstacles to plant synthetic biology...ve had to navigate the challenges involved in plant synthetic biology. Challenge #1: Public perception ...facilitates plant science. Challenge #3: Intellectual property There is another challenge associated with molecular... of well-characterized genetic tools make it challenging to engineer a specific function in these multicellular...fibers. And because working with plants can be challenging, there are a lot of unexplored areas in plant...manner. At Revolution Bio, we are addressing this challenge directly by developing a plant biotechnology product... a product without the use of these parts is challenging, and it’s made even more difficult by the fact...

  5. The Challenges of Cell Culture

    Type
    Blog Post
    ...Henrietta Lacks. New York: Crown Publishers, 2010. 2. Gold, Michael. "A conspiracy of cells." State University...

  6. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...of basal H 2 O 2 levels with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with...Belousov Hydrogen Peroxide (H 2 O 2 ) Cytosolic or mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) ...peroxiredoxin-2-based probe. Nat Commun. 2018 Aug 7;9(1):3145. Hadley Sikes Hydrogen Peroxide (H 2 O 2 ) Monitoring...encoded Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi...Fast red fluorescent calcium sensors (fRCaMP1/2, fRGECO1/2) The kinetic mechanisms of fast-decay red-fluorescent...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET ... eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn(2+) Imaging...

  7. Control AAV Preps

    Type
    Collection
    ... 1, 2, 5, 8, 9, 11, rg*, PHP.eB Bryan Roth 50469 pAAV-CaMKIIa-EGFP CaMKIIa EGFP Constitutive 1, 2, 5, ...Constitutive 2 Marcella Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry Constitutive 1, 2, 5, 8, 9, ...Constitutive 1, 2, 5, 8, 9, rg* Karl Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 1, 2, 5, 8, 9, rg...dependent 1, 2, 5, 9, rg* Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9...dependent 1, 2, 5, 8, 9, rg* Bryan Roth 50459 pAAV-hSyn-DIO-mCherry hSyn mCherry Cre dependent 1, 2, 5, 8, ...dependent 1, 2, 5, 8, 9, rg* Karl Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 5, 8, ...Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 6, 8, 9, 11, rg*, PHPeB, CAP-B10, CAP-B22, MaCPNS1...

  8. Genetic Code Expansion

    Type
    Collection
    ...Schultz 48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian...4xEcoLeuT(CUA)_AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian...Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73546 pEvol-pAzFRS.2.t1 pAzFRS.2.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...archaeon S-(4-cyanopyridin-2-yl)-L-cysteine (CysCNP) and S-(4-cyanopyrimidin-2-yl)-L-cysteine (CysCNPym)...Jesse Rinehart 71403 pCMV-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial,...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...

  9. p53 Pathway

    Type
    Collection
    ...CCNB1 CCNB2 CCNB3 Cyclin B1, 2, or 3 Cyclin D CCND1 CCND2 CCND3 Cyclin D1, 2, or 3 Cyclin E CCNE1 CCNE2 ...kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2 (RFWD2); E3 ubiquitin protein...SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2 TSP1 Thrombospondin... Spring Harbor Perspectives in Biology. 2010 Feb;2(2):a001107. PMC PMID: 20182618 . Do you have suggestions...threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed 1; also known as GTSE1 BAI-1...inhibitor 1A p48 Damage-specific DNA binding protein 2, 48kDa p53 Tumor protein p53 p53AIP1 Tumor protein... domain protein 1 PIGs Etoposide induced 2.4 PIRH-2 Ring finger and CHY zinc finger domain containing ...

  10. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...HPS, HPS2, PE AZGP1 alpha-2-glycoprotein 1, zinc-binding ZA2G, ZAG B2M beta-2-microglobulin - CALR calreticulin...

  11. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks...101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP... AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP-117 mEGFP RPB1 RNA polymerase...mEGFP AICSDP-77 mEGFP Telomeric repeat-binding factor 2 (TRF2) Telomeres 168799 CTCF-mEGFP AICSDP-144 mEGFP...Nucleolus (granular component) 133963 UBTF-HaloTag AICSDP-80 HaloTag Nucleolar transcription factor UBF Nucleolus...

  12. Zhang Lab CRISPR Page

    Type
    Collection
    ...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014...

  13. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...26355004 Mendenhall CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1...26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-...

  14. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid...GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 76,441...Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637...172651 (Set D) Knockout Human Doench and Root 2nd 2 40,710 Inzolia Human CRISPR/Cas12a Multiplex Knockout...3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 2,852...MinLibCas9 Library 164896 Knockout Human Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library...Library (Gattinara) 136986 Knockout Human Doench 3rd 2 40,964 Ingolia lab S cerevisiae CRISPRi v1 – barcodes...

  15. Rett Syndrome

    Type
    Collection
    ... mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an X-linked disorder...X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens in a new window... Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity... Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology...males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67... results in approximately half of cells expressing wild-type MECP2 and half expressing mutant MECP2 . ...Kankirawatana et al. 2006. Early progressive encephalopathy in boys and MECP2 mutations. Neurology . 67...

  16. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Layer 2-3_IT Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT ...AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531 pAAV-AiE2150m-minBG-SYFP2...formation Cortical subplate Striatum Pallidum Hypothalamus Cerebellum Whole brain Addgene ID Plasmid Allen...

  17. Biosensor AAV Preps

    Type
    Collection
    ...dependent 1, 2, 5, 9 Kim , GENIE 100836 pAAV.CAG.GCaMP6f.WPRE.SV40 CAG GCaMP6f none Constitutive 1, 2, 9 Kim...Constitutive 1, 2, 9 Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP..., Huebener , Rose 83899 pAAV-mDlx-GCaMP6f-Fishell-2 Dlx GCaMP6f none Constitutive 1, 9, rg* Fishell 100833....v857.PDGFR CAG iGluSnFr3 v857 none Cre dependent 2 Podgorski 234437 pAAV-syn-iGluSnFR4s-NGR-WPRE Syn ...pAAV-hSyn-GRAB_g5-HT3.0 Syn GRAB_g5-HT3.0 none Constitutive 1, 2, 8 Li No available items found to match all requested...Schreiter Calcium Sensor: HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1...jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a HaloCaMP1b NIR-GECO Acetylcholine Sensors iAChSnFR ...

  18. TALEN Guide

    Type
    Collection
    ...par with ZF arrays, if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove...variety of backbones in just a few steps ( Figure 2 ). The Bogdanove group also hosts web-based software...mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53. PMID: 21248753 . TALEs for the masses. Rusk...led by Jens Boch at the Martin-Luther-University Halle-Wittenberg and Adam Bogdanove at Iowa State University...into a single construct would be technically challenging. Thanks to efforts by the Bogdanove group and...

  19. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang...Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. 2015. CETCh-seq: CRISPR epitope...

  20. Plasmids for Stem Cell Research

    Type
    Collection
    ...mouse somatic cells. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. Jaenisch Lentivirus Mouse Polycistronic, ...Nature of Induced Pluripotency. Cell. 2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of ...self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54. Dowdy Adenovirus Mouse Non-integrating expression...reprogramming in mouse. Cell Stem Cell. 2008 Mar 6. 2(3):230-40. Hochedlinger MMLV-derived Retrovirus Mouse...Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic...Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral Human ...

  21. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa...modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID 18657511 . Oligomerized pool... Method Full Target Site (5' to 3') Left half-site Right half-site CACNA1F OZ507 and OZ508 OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg...on the length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more ...and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt...

  22. Neurodegeneration Research Collection

    Type
    Collection
    ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...Rep. 2023 Aug 30. Enhance differentiation to mesencephalic dopaminergic (mesDA) neurons using gene knockout...

  23. Optogenetics AAV Preps

    Type
    Collection
    ...H134R)-EYFP CaMKII ChR2/H134R EYFP Constitutive 1, 2, 5, 9 Karl Deisseroth 26973 pAAV-hSyn-hChR2(H134R)...H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5, 9, rg*, PHPeB Karl Deisseroth 26975 pAAV-CaMKIIa-hChR2....WPRE.SV40 CAG ChR2/H134R mCherry Constitutive 1, 2, 5, 9 Karl Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R...pAAV-EF1α1.1-ChrimsonR-GFP EF1a ChrimsonR GFP Constitutive 2 Edward Boyden 124650 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1...pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR 3.0 EYFP Constitutive 2, 5 Karl Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF...AAV collection, including channelrhodopsins, halorhodopsins, and more. Viral...

  24. Mammalian RNAi Tools

    Type
    Collection
    ...degrades the mRNA. RISC includes argonaute protein 2 (Ago2), which facilitates cleavage of the target. ... International Journal of Biomedical Science, 13 (2), 48–57. PubMed (Link opens in a new window) . Moore...PubMed (Link opens in a new window) . Dana, H., Chalbatani, G. M., Mahmoodzadeh, H., Karimloo, R., Rezaiean...

  25. CRISPR Guide

    Type
    Collection
    ...Browse Plasmids: Double-Strand Break (Cut) Figure 2: Overview of the NHEJ repair mechanism. Multiplex ...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...

  26. CRISPR Plasmids - Tagging

    Type
    Collection
    ...gene-specific CRISPR and donor vectors as well as pX330S-2-PITCh, expressing a generic gRNA targeting the PITCh...Protocols, 2016 . Yamamoto Tagging Plasmids: pX330S-2-PITCh - expresses Cas9 & PITCh-gRNA pX330A-FBL/PITCh... your gene of interest Mendenhall and Myers Tagging System The Eric Mendenhall and Richard Myers labs ...homology arm cloning: Mendenhall & Myers FETCh-seq Protocol 134.7 KB Mendenhall and Myers Tagging Plasmids... the homology arms for the donor plasmid. The Mendenhall and Myers labs have also provided their protocol...

  27. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...8661 p4455 FLAG-hPLIC-2 UBQLN2 Flag CMV ALS Peter Howley 8662 p4456 FLAG-hPLIC-2 NTF UBQLN2 Flag CMV ALS...196208 GB1-A11(2-196)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196209 GB1-A11(2-196, G38R)-Strep...196210 GB1-A11(2-196, D40G)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196211 GB1-A11(2-196, G175R...196212 GB1-A11(2-196, G189E)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196213 GB1-A11(2-52)-Strep ...ATFA) LRRK2 Halo EF1-alpha Parkinson's Shawn Ferguson 229744 pPB-EF1A-HALO-hLRRK2 (LIR1+2 mutant WEVL ...TLS 1: hTLS.pBSKS(+) FUS T7 ALS David Ron 21828 TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS 3: TLS.pRSET.C...ApoE Alzheimer's Sohail Tavazoie 51436 pGL3Basic-ME.2/ApoEpromoter APOE ApoE Alzheimer's Sohail Tavazoie...

  28. AAV Viral Preps

    Type
    Collection
    ...AAV vectors for trial purposes in serotypes AAV1, 2, 5, 6, 8, 9, 11, and retrograde Retrograde AAV To ...DREADDs, PSAMs Optogenetics Channelrhodopsins, Halorhodopsins, Archaerhodopsins Recombinases Cre, Flp, Dre...

  29. Plan Your Experiment

    Type
    Collection
    ...components (Figure 2), and the optimal system will likely depend on your cell type. Figure 2: Different delivery...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells that...CRISPR-Based genome editing. Trends in Biotechnology , 36 (2), 173–185. https://doi.org/10.1016/j.tibtech.2017.11.006...generally higher than HDR pegRNA optimization can be challenging Prime Edit Repress or Interfere (CRISPRi) Reduce...

  30. CRISPR References and Information

    Type
    Collection
    ...Link opens in a new window) An encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...library amplification 1 vector system: lentiCRISPR v2 2 vector system: lentiCas9-Blast and lentiGuide-Puro...pCRISPR new spacer cloning pCRISPR PDF, 109 KB Mendenhall and Myers Mammalian: FLAG tagging endogenous ...tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF, 49 KB Vosshall and Matthews (Link opens in a new window) CRISPR...

  31. Optogenetics Plasmid Collection

    Type
    Collection
    ...optogenetic tool is the widely used Channelrhodopsin-2 (ChR2) from Chlamydomonas reinhardtii . ChR2 is a ... cells. Other microbial opsins, such as the Halorhodopsins, Archaerhodopsins and Leptosphaeria rhodopsins...

  32. Distribution to Industry

    Type
    Collection
    ...Collections NEW NanoLuc and HaloTag Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent...agreements allow Addgene to distribute plasmids on behalf of the depositing institutions. These agreements...signatory is someone who can execute legal documents on behalf of the recipient institution. Once the MTA has ...

  33. Deisseroth INTRSECT Collection

    Type
    Collection
    ...dual-transgenic recombinase-expressing mouse lines 2–9 and combinations of transgenic recombinase-expressing...delivering additional recombinases 10–14 . Figure 2: INTRSECT works by inserting short, intronic sequences..., Deisseroth K, Carlén M, Meletis K. 2019. A hypothalamus-habenula circuit controls aversion. Mol. Psychiatry... Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal Circuits through the Parafascicular Nucleus...window) Marcinkiewcz CA, Mazzone CM, D'Agostino G, Halladay LR, Hardaway JA, DiBerto JF, Navarro M, Burnham...

  34. Luciferase Plasmid Collection

    Type
    Collection
    ...transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression of firefly luciferase...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Luminopsins : Luciferase-opsin fusion...firefly and Renilla luciferase have short protein half-lives, making them useful as transcriptional reporters...Constructs using NanoLuc® as a BRET energy donor and HaloTag labeled with a fluorophore as the acceptor. LumiFluors...TREAT : Biosensor using Renilla luciferase and a Halo tag to assay mRNA turnover in real time. Nonsense-mediated...

  35. E11 Bio PRISM Collection

    Type
    Collection
    ...optical imaging down to individual synapses. Figure 2: PRISM workflow. A) Stochastic infection of pooled...Leible, D., Leung, K.S., Magno, C.A., Meeran, A., Michalska, J.M., Rieger, F., Wang, C., Wu, M., Church, G.M...

  36. TALEN Plasmids and Kits

    Type
    Collection
    ...Golden Gate TALEN Kit and are used in place of pTAL1, 2, 3, or 4. For both plasmids sequence positions 1214...TALEN Kit 49042 EMM65 Bradley Bernstein and Eric Mendenhall The TALE plasmid vectors described on this page...4 (H3K4) di-methylation at the target locus ( Mendenhall et al., 2013 ). This epigenome editing was also...49044 EMM71T Golden Gate TALEN 2.0 49401 pBlue-TAL Michal Zurovec pBlue-TAL was designed for use with the...

  37. Tetracycline Inducible Expression

    Type
    Collection
    ...hSyn promoter rtTA3 Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter...expression and improved dynamic range . Hum Gene Ther, 22 (2), 166–176. https://doi.org/10.1089/hum.2010.099 (Link... good tissue distribution, low toxicity, a known half-life (24 hours), and is relatively inexpensive. ...

  38. Fluorescent Proteins: FRET

    Type
    Collection
    ...referred to as intermolecular or bimolecular FRET) or (2) conformational changes within a protein where the...standards mCerulean-mVenus FRET efficiency standards Thaler et al. (2005) Quantitative multiphoton spectral... can also incorporate organic fluorophores via HaloTag or SNAP-Tag . Read more about self-labeling tags...

  39. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...- Bacterial Expression mScarlet-I3 568 592 68 4.2 2 min Monomer pmScarlet-I3_C1 - Mammalian Expression... Vector - Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag - ...Plasmids HaloTag Chloralkane (CA) pMH-Halo tag - Mammalian Gateway Destination Vector pENTR4-HaloTag (w876...Entry Vector pCS2+/C-Halo , pCS2+/N-Halo - Xenopus Expression pET51b-His-TEV-HaloTag7 - Bacterial Expression...intensity drops to half its maximum value. Maturation is the time for fluorescence to reach half its maximal ...
Showing: 1 - 40 of 303 results