We narrowed to 412 results for: his
-
TypeCollection...Gap junctions 109121 HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP ...
-
CRISPR Plasmids - Mammalian Expression
TypeCollection... Available modifications include histone acetylation by p300, histone demethylation by LSD1, cytosine ... -
TALEN Plasmids and Kits
TypeCollection... was recently shown that TALE fusions with the histone demethylase LSD1 (Lysine specific demethylase) ...with the FLASH method can decrease the amount of Histone H3 lysine 4 (H3K4) di-methylation at the target... -
Sequencing Primers
TypeGuide...reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward...forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R,...primer HAT GAGGAGCACGCTCATGCCCAC (BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA... -
Promoters
TypeGuide...general transcription factor proteins and histones can bind. Histones are proteins found in eukaryotic cells...cells that package DNA into nucleosomes. Histone binding prevents the initiation of transcription whereas... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...e.g. bacterial, yeast, or mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-... -
All Antibodies
TypeCollection...species. We currently assess western blot, immunohistochemistry, and immunocytochemistry. Addgene will continue... -
Botman-Teusink Yeast FP Collection
TypeCollection...Lee et al., 2013), and are available with URA3, SpHIS5 and KANMX markers. The FP together with the protothropic... -
CRISPR Plasmids and Resources
TypeCollection...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial... -
Antibody Production
TypeCollection...is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are fixed, permeabilized... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...and OZ548 OPEN OPEN gAGCTCCGTCtcgctgGCGGCCGAAg histamine receptor H3 (hrh3) OZ549 and OZ550 OPEN OPEN gCGCCACGGAcaataaaGAGGACTGCa... -
Microbiology Resources
TypeCollection...Prions Plasmids for Protozoa Species Entamoeba histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii... -
p53 Pathway
TypeCollection...TP53 dependent G2 arrest mediator candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...Recombinant Adeno-Associated Virus Vector Expressing Retinoschisin. Hum Gene Ther Clin Dev . Sep;26(3):165-76. ... -
CRISPR Guide
TypeCollection... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers...153 (4), 910–918. PMID: 23643243 Zhang, Y., & Marchisio, M. A. (2020). Type II anti-CRISPR proteins as... -
Lentivirus Plasmids
TypeCollection...plasmid 14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-pLKO-puro 3rd inducible expression of... -
Neurodegeneration Research Collection
TypeCollection...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGGCCAAAGAAAAGGACGcgataagaaagtttgtTGTGGCTCAACTGCAGAA hist2h3ca1 TAL3284 & TAL3285 TCTGTTTGAGGACACCAAcctgtgcgccatccacgCCAAGAGGGTCACCATCA... -
Optogenetics AAV Preps
TypeCollection...ChrimsonR (soma-targeted) GCaMP8s Cre dependent 9 Histed 183519 pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE... -
27 Hot Plasmids from 2016
TypeBlog Post...large-scale expression screen that can be used to generate His-tagged human kinase constructs that express well ... Saccharomyces strains by compensating for histidine (HIS3), leucine (LEU2), uracil (URA3), methionine...epigenetic modifiers like DNA methyltransferases or histone deacetylases. Unfortunately, these inhibitors are...were validated by both Western blotting and immunohistochemistry, and are summarized in the table below: ...