Skip to main content

We narrowed to 413 results for: his

Showing: 221 - 240 of 413 results
  1. Genetic Code Expansion

    Type
    Collection
    ...Mammalian TAG Abhishek Chatterjee 217365 pIDTSmart-CMV-PLRS1 LeuRS E. coli Mammalian Abhishek Chatterjee ...PylRS M. barkeri azidolysine (AzK) Mammalian TAG Abhishek Chatterjee 217364 pAcBac1-BacMam-4x-PyOtR PyOtR...-h14 (S8A, V144G, V146C) E. coli Bacterial TGA Abhishek Chatterjee 218765 pEvoltac EcW-TGA-h9 TrpRS-h9...TrpRS-h9 (S8A, V144S, V146A) E. coli Bacterial TGA Abhishek Chatterjee 218766 pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA...D182S, F183M, L186A, D265R) E. coli Bacterial TAG Abhishek Chatterjee 218767 pEVOL-tac-EcTyrRS-pAAFRS-9-lpp-tRNA_CUA...D182C, F183Y, L186C, D265R) E. coli Bacterial TAG Abhishek Chatterjee 220800 EF1a-L274GMmMetRS-T2A-mCherry...coli 5-Hydroxytryptophan (5-HTP) Mammalian TGA Abhishek Chatterjee 228782 pAcBac1-EcTyr-TAG TyrRS E. coli...
  2. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...p15TV-L EF456736 Hexahistidine tag with TEV cleavage, AmpR 26093 pET15-MHL EF456738 Hexahistidine tag with TEV...GST-tag and hexahistidine tag with Thrombin cleavage, KanR 26096 pET28-MHL EF456735 Hexahistidine tag with...26117 pNIC-CH EF199843 Hexahistidine tag, AmpR 26103 pNIC28-Bsa4 EF198106 Hexahistidine tag with TEV cleavage...EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106 pNH-TrxT GU269914 Hexahistidine tag, thioredoxin...GU452710 Hexahistidine tag , Z-basic, TEV cleavage, AmpR 26108 pFB-LIC-Bse EF199842 Hexahistidine tag with...TEV cleavage, AmpR 26094 pET28a-LIC EF442785 Hexahistidine tag with Thrombin cleavage, KanR 26101 pET28GST-LIC...ptac promoter, AmpR 26099 pFBOH-LIC EF456740 Hexahistidine tag with Thrombin cleavage, Bac-to-Bac Baculovirus...
  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ...-A major histocompatibility complex, class I, A FLJ26655, HLAA HLA-B major histocompatibility complex,...major histocompatibility complex, class II, DM beta D6S221E, RING7 HLA-DOA major histocompatibility complex...HLA-DOB major histocompatibility complex, class II, DO beta DOB HLA-DPA1 major histocompatibility complex, ...major histocompatibility complex, class II, DQ alpha 2 HLA-DXA HLA-DQB1 major histocompatibility complex...major histocompatibility complex, class II, DR alpha HLA-DRA1 HLA-DRB1 major histocompatibility complex... HLA-G major histocompatibility complex, class I, G MHC-G HLA-H major histocompatibility complex, class...protein-coupled receptor 77 C5L2, GPF77 HTN3 histatin 3 HIS2, HTN2, HTN5 IL8 interleukin 8 CXCL8, GCP-1,...
  4. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...206528 Anti-Histone H3 pThr11 [N123/19R] Histone H3 pThr11 Rat Mouse IgG2a 206529 Anti-Histone H3 pThr11...28R] HCN3 Mouse Mouse IgG2a 177500 Anti-6xHis [N144/14R] 6xHis Mouse IgG2a 177501 Anti-TrpV3 [N15/4R] ...Pan-Gamma-protocadherin-A Mouse IgG2a 182106 Anti-Histone H3.3 [N158/28R] Histone H3.3 Rat Mouse IgG2a 182107 Anti-LRRTM2...Mouse Mouse IgG2a 206552 Anti-Histone H4-dimethyl-Arg3 [N309A/21R] Histone H4-dimethyl-Arg3 Human Mouse...musculus (mouse) IgG2b 227037 6xHis recombinant mouse monoclonal antibody. 6xHis Chimera: M. musculus (mouse... Mouse IgG2a 188214 Anti-GST [N100/13R ] GST Schistosoma japonicum Mouse IgG2a 188215 Anti-TrpC7 [N64A...pThr11 [N123/48R] Histone H3 pThr11 Rat Mouse IgG2a 206530 Anti-Haspin/GSG2 [N128A/2R] Haspin/GSG2 Human Mouse...
  5. TALEN Plasmids and Kits

    Type
    Collection
    ... was recently shown that TALE fusions with the histone demethylase LSD1 (Lysine specific demethylase) ...with the FLASH method can decrease the amount of Histone H3 lysine 4 (H3K4) di-methylation at the target...
  6. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...for targeted epigenetic modification, including histone acetylation/demethylation, and cytosine methylation...
  7. Sequencing Primers

    Type
    Guide
    ...P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG 5' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG...TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA...GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3'...
  8. All Antibodies

    Type
    Collection
    ...species. We currently assess western blot, immunohistochemistry, and immunocytochemistry. Addgene will continue...
  9. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...Lee et al., 2013), and are available with URA3, SpHIS5 and KANMX markers. The FP together with the protothropic...
  10. CRISPR Plasmids and Resources

    Type
    Collection
    ...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial...
  11. Antibody Production

    Type
    Collection
    ...is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are fixed, permeabilized...
  12. Microbiology Resources

    Type
    Collection
    ...Cryptococcus sp. Plasmids for Protozoa Entamoeba histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii...
  13. p53 Pathway

    Type
    Collection
    ...TP53 dependent G2 arrest mediator candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins...
  14. Lentivirus Plasmids

    Type
    Collection
    ... Thy1.1 selection. Christophe Benoist and Diane Mathis 21915 Tet-pLKO-puro 3rd Inducible expression of...
  15. CRISPR Guide

    Type
    Collection
    ... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers...153 (4), 910–918. PMID: 23643243 Zhang, Y., & Marchisio, M. A. (2020). Type II anti-CRISPR proteins as...
  16. Optogenetics AAV Preps

    Type
    Collection
    ...ChrimsonR (soma-targeted) GCaMP8s Cre dependent 9 Mark Histed 183519 pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE...
Showing: 221 - 240 of 413 results