We narrowed to 718 results for: des.1

... such a popular model organism? Zebrafish (Figure 1) were initially recognized as a useful vertebrate ...deactivation method in zebrafish are short, modified oligonucleotides called morpholinos. When injected into zygotes...CRISPR/Cas9-mediated insertion of foreign DNA. Despite these caveats, several features of zebrafish—including...

...again. Here’s that process!   Figure 1: The Design-Build-Test-Learn cycle adapted for video making...Good as a WFH desk, and as a video control center.   Cycle 2: Zooming Forward Design: We produced ... So, much like SynBio, it was time to start our Design-Build-Test-Learn cycles. If you’re not familiar...through. I know cameras, but we needed someone else. Design: Jennifer thankfully volunteered, and we decided...here, the operator is in a different room.   Design: The previous cycle made me realize we needed to...restrictions in place, most importantly, masks.  Besides the muffled voices beneath masks, humans rely on...reach for Addgene.  So, onto research! I needed to design a system that would allow me to set up a camera...

...commandments for making it all work – most of the time. #1 Thou shalt find enjoyment in your work If you are ...that extra two miles which is way more fun. And despite those who may wish to tell you so – towel corners...

...first foray into Reddit. Here are some reasons why: 1. Reddit has a large and active community of people...They also host AMA forums where users can ask designated scientists anything about a particular topic....calendar invite over to the r/Science team with a description of our AMA and Joanne’s preferred time to start...was writing all day and straight on through her designated two hours for answering questions. She was able...toxic advisors, fruitless job searches, and even despair at having chosen an academic past. I hope I was...receive via email. The cool features are too many to describe here, but I have over 2,000 notes which Evernote...

...email Ryan at [email protected]   References 1. Larivière, Vincent, Yves Gingras, and Éric Archambault.... After months, or years, of grueling effort to design, fund, and conduct a research project, the vast...provide more than enough time for researchers to describe their science, and for viewers to decide if reading...is of interest. In his research, Scott Spicer concludes that “… the emergence of the video abstract genre...websites). WeShareScience is a social platform that provides links to the videos, keeping the copyright and...

...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD... with a specifically designed Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...

...levels of DnaA to get the job done.   Figure 1: DNA melting by DnaA and IHF is the first step of ...replicate—but not always to the same extent. As described in our previous Origin of Replication post, DNA...replication. For example, the plasmid ColIb-P9 encodes the protein RepZ to drive its own replication. ...

...conference for any reason was a Singleton. Figure 1: The Binning Singletons logo. Image: James et al.,...was that kid who used recycled notebook paper, despite the fact that it was gray. He has worked in molecular...molecular and microbiology for the last two decades as a staff scientist, but before going to graduate ...

... panel design. Find streptavidin plasmids and biotin plasmids at Addgene!     Figure 1: Indirect... this system is increased flexibility for panel design. Another perk is that one primary antibody can ...for example, a previously induced gene knockout. Besides amine- and DNA-binding dyes, nucleoside analogs...walk through the topics we covered in this post. Besides direct labeling, indirect labeling can be used ...surface, dump gating is a useful way to get rid of undesired cell populations. Dump gating uses the same color...

...collaborations, keep these jobs in mind! References 1. Sinche, Melanie, et al. "An evidence-based evaluation...collaborators than you realize. Being at a university provides the perfect platform for practicing initiative...

...complex. So how exactly does this work? Figure 1: APOBEC- and Cas9-mediated editing (ACE) reporter ... plasmid delivery to a cell. In contrast, TREE provides a read out for plasmid delivery and subsequent...

...M. M., Semenova, E., Severinov, K., De Vos, W. M., Dame, R. T., De Vries, R., Brouns, S. J., & Van Der...changing the target sequence present in the gRNA. Figure 1: Overview of the basic CRISPR mechanism. CRISPR was...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex to initiate DNA degradation. Cascade...Cascade C RISPR- as sociated c omplex for a ntiviral de fense; a complex of multiple Cas enzymes including...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...

...fragment that needs to be amplified should be within 1-10 kB in size. The structure of the primer should ...18-24 bases 40-60% G/C content Start and end with 1-2 G/C pairs Melting temperature (Tm) of 50-60°C Primer... Protocols Designing Primers How to Design a Primer You may also like...Tips on designing primers for PCR Protocols...Cloning by PCR Agarose Gel Electrophoresis Primer Design for PCR Oligonucleotide primers are necessary when... when running a PCR reaction. One needs to design primers that are complementary to the template region.... They are synthesized chemically by joining nucleotides together. One must selectively block and unblock...

...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...Oncolytic Referring to the destruction of cancer cells, generally by lysis. pAdEasy-1 Adenoviral backbone plasmid...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or... This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli ... viruses. The adenoviral backbone plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For...production system. Figure is based on the use of pAdEasy-1. Created with BioRender.com. AdMax™ AdMax™ is another...landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392-021-00487-6 (...

...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...

...’re not one of these people yourself.  Fig 1: Quote from Michael Ende, courtesy of morefamousquotes.com...even better. The Thomas Kilmann Conflict Model describes 5 basic approaches to conflict resolution based...

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate TALEN and...functional genetic circuit. Level 2 vectors are often designed with flexibility to allow for additional iterations...MoClo kits in our collection. Kit name Type PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet...

...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in the...every item I tested was constantly tracked with barcodes and spreadsheets. It was great to be in the lab...industry positions. There were, however, some downsides to working in a large commercial company. In my...aspects of the company and gave me the freedom to design new projects and grow in the role. I understand... job different every day. I love the freedom to design and develop my own projects, but working remotely...

...Bachelor's degree Generally a short-term position (1-2 years) Often a gap-year position taken to transition... are more involved in the science, experimental design, and execution. Can lead to an independent project...advice Give yourself permission to pursue your own desired path. Careers in science are also not limited to...

...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L... Science Guides Optogenetics Guide Optogenetics Guide Jump To: ...cell membrane. Microbial opsins, such as those described below, can be targeted and expressed in specific...

...transcribed gene (Figure 1). The coding strand is the DNA strand that encodes codons and whose sequence...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...or inducible expression. Promoter Expression Description T7 Constitutive Promoter from T7 bacteriophage...different conditions. Promoter Expression Species Description Ac5 Constitutive Insect Strong promoter from ...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...primers. You can also use Addgene’s protocol to design your own primers . Still have questions about choosing... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...

...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell... Science Guides Viral Vectors AAV Vector Guide Adeno-Associated...inverted terminal repeats (ITRs). The Rep region encodes four non-structural replication proteins (Rep78...

...start designing the specific components (Cas enzyme and guide RNA) for your experiment (Figure 1). You...gRNA), the design of the gRNA sequence, and finally how to validate your genetic edit. Figure 1: Flow chart...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...used for gRNA design. Read more about how to design your gRNA . Synthesize and Clone Desired gRNAs Once ...multi-plasmid SAM system Activate Design and Clone Your gRNA Achieving your desired edit comes down to location...on proper gRNA design. While there are some cases where it makes sense to manually design a gRNA, in most...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...pairs with G. The order of nucleotides makes up the genetic code and provides the instructions to make ...thymine in RNA molecules. Every 3 nucleotides (codons) in a DNA sequence encodes for an amino acid. The genetic...double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form hydrogen ...

...Retroviral Vector Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com...PMID: 24501411 Gilroy, K. L., Terry, A., Naseer, A., De Ridder, J., Allahyar, A., Wang, W., Carpenter, E.... Science Guides Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral...been widely used in the research community for decades. Wildtype gamma-retroviruses have been engineered...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...

...also negatively affect data reproducibility. Figure 1: Simplified flow chart for amplifying and using a ... Science Guides Guide to Plasmid Pooled Libraries Plasmid Pooled...effects of expressing multiple genes at once. A well-designed screen can help you begin to understand what genes...important to a certain phenotype, and allow you to design additional hypothesis-directed experiments. As ...tube. Pooled libraries can be small, if they are designed to cover only a subset of genes, or very large...

...of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone...marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map of pLKO.1 containing an shRNA...puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...

...Volume of 1 mg/mL PEI (μL) 1:1 18.9 18.9 1:2 18.9 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9...were transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high.... Thawed aliquots should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000 Da ...stable. Dilute 1:3 (µg DNA:µg PEI) in 500 µL total of OptiPro SFM (per 10 cm plate). 56.7 µL of 1 mg/mL PEI...subclone of HEK293T optimized for viral production) Day 1: Transfect Cells Day 2 (am): 18 h post transfection...to be empirically determined for each new batch of 1 mg/mL PEI prepared. There may be variation between...plasmid using a variety of ratios. Check the cells 1–2 days after transfection to determine what ratio ...

...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M sodium phosphate...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M of sodium phosphate...protease inhibitor cocktail. Add 1 part Protein A/G binding buffer to 1 part tissue culture supernatant...Choose Option 1 or Option 2 based on the concentration of the pooled sample above. Option 1: Buffer exchange...antibody to 1 mg/mL with PBS if needed. For long term storage, add sterile sodium azide to 1 mM. Option... proceed to Option 1 with a buffer exchange using a Zeba Spin 7 kDa MWCO desalting column. If the concentration...purify recombinant antibodies. Workflow Timeline Day 1: Purify antibody Day 2 or later: Buffer exchange Equipment...

...DNA μL of 1 mg/mL PEI 1:1 18.9 18.9 1:2 18.9 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9 113.4...μg total DNA to μg PEI ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided...: Monday: Plate 1×10 6 cells in a T75 flask in 15 mL DMEM Complete. Wednesday: Plate 1×10 6 cells in a...Workflow Timeline Day 0: Seed 293T packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection...inactivated in the lab by heating to 56°C for 30 min. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) ...to be empirically determined for each new batch of 1 mg/mL PEI and for each cell line. Considerations Before...enough PEI such that the ratio of μg DNA:μg PEI is 1:3 (1000 μL total per 10 cm dish). Using transfer plasmid...

...Dilution 1 (20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400)...95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold 4 ...Use a single channel 1–10 µL pipette to add 5 µL of each viral sample to Dilution 1 in the 48-well dilution... 95 µL 1X PCR buffer (1:8,000) Dilution 4 (20X): 5 µL in 95 µL 1X PCR buffer (1:160,000) Dilution 5 (20X...95 µL 1X PCR buffer (1:3,200,000) Dilution 6 (2X): 50 µL in 50 µL 1X PCR buffer (1:6,400,000) Dilution ...50 µL 1X PCR buffer (1:12,800,000) Dilution 8 (2X): 50 µL in 50 µL 1X PCR buffer (1:25,600,000) Use multichannel...pipettes for the dilution series. For dilutions 1–5, use the 1–10 µL multichannel pipette set to 5 µL. For...

...biosafety levels. This protocol provides information for both biosafety level 1 (BSL-1) and biosafety level 2 ...(PPE) for BSL-1 and BSL-2 labs. Protocols... Protocols Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs...Labs Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more ...2 (BSL-2). The BSL-1 classification is for labs working with low-risk microbes posing little to no threat...all of the precautions needed in BSL-1, however there are additional precautions that lie beyond PPE. Video...always wear glasses/goggles in addition to the BSL-1 requirements. Conclusion Although simple, following...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for... is described in more detail in the Multiplex Assays section below. The following table describes the ... Science Guides Antibody Guide Antibody Guide View Addgene's Antibody...of B cells isolated from animals immunized as described above are used to create hybridomas, which produce...each antibody has two binding sites. Isotype Description Configuration and Valency Subclasses IgA Prevalent... used to quantify relative amounts of protein. Includes: Western blot ELISA Capture - used to isolate ...

...biosafety levels. This protocol provides information for both biosafety level 1 (BSL-1) and biosafety level 2 ...level has different safety requirements. BSL-1 is designated for those working with microbes that don’t ...or Vibrio cholerae . BSL-2 includes all of the precautions needed in BSL-1, along with additional precautions...guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...Safety for Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols...container Fire blanket Fire extinguisher Guidelines BSL-1 Guidelines Before You Work Right after entering the...hygiene officer. BSL-2 Guidelines Remember, the BSL-1 laboratory guidelines above are expected to be followed...

...tissues: use 1 mL of Solution D per 100 mg of cells. For cultured cells: use 1 mL of Solution D per 1 X 10 7...tissues: use 1 mL of TRIzol® per 100 mg of cells. For cultured cells: use 1 mL of TRIzol® per 1 X 10 7 cells... to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL water-saturated...Option A): Add 1 volume of Isopropanol to the extracted aqueous layer. Incubate at -20°C for 1 hour. Lithium.... Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used. Shake vigorously by hand for... User Guide from ThermoFisher Scientific . Figure 1: A diagram of the different steps in RNA extraction...

...7.5% Sodium Bicarbonate, 7.5 mL 1 M HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) ...Calculate the amount of each plasmid needed to have a 1:1:1 molar ratio with 2 mg total DNA per CS5 Plasmid ... determine the total μg/bp we need to achieve a 1:1:1 molar ratio of each plasmid: 2000 μg / 24,961 bp...deionized water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride...high glucose, Corning 10-013-CV DMEM, low glucose (1 g/L) glucose, sodium pyruvate, Corning 10-014-CV (... sodium bicarbonate, Corning 25-035-CI (optional) 1 M HEPES, HyClone SH30237.01 (optional) L-alanyl-L-glutamine...cations can affect the attachment of adherent cells) 1 mg/mL Polyethylenimine (PEI) 25 kDa MW Pro-Tip Other...

...Data Figure 1: The plate was coated with serial dilutions of human recombinant purified Desmin (blue) or...avoid breathing in the vapors. Workflow Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody... Spectrophotometer compatible with 96-well plates 1–10 µL single channel pipette 2–20 µL single channel... µL, VWR 76322-134 Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4...Warm reagents to room temperature. Procedure Section 1: Prepare the Antigen Standard and coat the plate Dilute...stock into 900 µL PBS in a microfuge tube and vortex. 1 ng/µL : Add 450 µL of 2 ng/µL stock into 450 uL PBS...microfuge tube and vortex. 0.5 ng/µL : Add 450 µL of 1 ng/µL stock into 450 µL PBS in a microfuge tube and...

...DNA 10-50 ng/μl 1 dGTP (100mM) 2.5 mM 2 DTT (100 mM) 5 mM 1 BSA (10 μg/μl) 0.25 μg/μl 1 T4 DNA polymerase... treated vector and insert at a molar ratio of 1:2 or 1:3, using between 20 and 50 ng of vector per annealing...experimental design. Search Addgene's collection of empty LIC cloning vectors Protocol Step 1: Design Your Primers...reaction for 5 minutes at room temperature, then add 1 μl of 25 mM EDTA, followed by another 5 minutes at...The reaction is now ready for transformation. Use 1-2 μl of annealing reaction for each transformation... Primers Primer design for LIC is often as simple as using the backbone manufacturer's suggested leader...primer is shown here. Note: Use web-based primer design software to ensure a melting temperature between...

...Because this is such a small volume, first make 1 mL of a 1:100 dilution of the homogenized cell solution... were transduced with lentiCas9-Blast 1 and then selected with 1 μg/mL blasticidin for 9 days. Single ...with lentiCas9-Blast 1 . A549 cells were transduced (MOI = 37) and selected with 1 μg/mL blasticidin for...control. 1 lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid #52962 ) and is described in Improved...conditioned medium (see below for more details) Day 1: Seed individual cells in a 96-well plate Day 2–14...final 5 cell/mL solution, transfer 12.5 µL of the 1:100 dilution to 10 mL of conditioned medium. Transfer...cells will appear as colonies in the well ( Figure 1 ). You will be able to tell if there was more than...

...Dilution 1:10 100 of Stock Virus 900 150 1,350 1:100 1:100 100 of 1:10 900 150 1,350 1:1,000 1:1,000 100...100 of 1:100 900 150 1,350 1:10,000 1:10,000 100 of 1:1,000 900 150 1,350 1:100,000 1:100,000 100 of 1... 1:10,000 900 150 1,350 1:1,000,000 Mix the dilutions well Note: the 1:10 dilution can usually be omitted...with 1 mL of 0.1% crystal violet for 10 min at RT. Gently remove the stain. Wash cells 3x with 1 mL of... media from the wells. Gently wash the cells with 1 mL of PBS and aspirate wash. Filter 0.1% crystal violet...volume in the well (mL) x dilution factor e.g., If the 1:100,000 well has 75 colonies, then there are 75 colonies...average of multiple dilutions. Sample Data Figure 1: A549 cells were transduced with the indicated serial...

...Vented Falcon Tubes at 30-37 ℃, 225 rpm for 1 hour. After the 1 hour shaking period, pool and gently mix ...follow all specifications described in the equipment manual. Immediately add 1 mL SOC to cuvette. Remove...Last Update: August 17, 2023 Workflow Timeline Day 1: Transform, recover, set up overnight growth (Estimated... (Default: 4 tubes of Endura Duos, Lucigen, 60242-1) Alternatives include Stbl4 cells or other ultra-high...0.1 cm ) 20 mL SOC recovery media (Lucigen, 80026-1) 8X LB Agar + Antibiotic 245 mm bioassay plates (Molecular...into each of four 14 mL Vented Falcon Tubes and have 1 mL SOC per electroporation readily available for post-electroporation...autoclaved, sterile reagents for all steps. Procedure Day 1 Add 200 ng DNA to each 50 µL aliquot of thawed Endura...

...mL polybrene (µL) 0 0 500 1:5 300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a... if an MOI >1 was used, some cells may have 1 copy of the transgene, while others have >1 copy of the ... well by pipetting or inverting the tube. Aliquot 1 mL of cell suspension (i.e., 50,000 cells) into each... early polyclonal populations. Sample Data Figure 1: Generation of monoclonal cell lines from expansion...transduced with lentiCas9-Blast and then selected with 1 µg/mL blasticidin for 9 days. Single cells were ...with Lentivirus You may also like... Viral Vector Guides Virus Blog Posts Mol Bio Protocols Viral Service...dilutions and pick the population that has the most desirable level of expression. Over time, transgene expression...

...95 10 2 1 Denaturation 94 0.5 2 40 Annealing/Extension 60 1 2 40 Enzyme Deactivation 98 10 2 1 Hold 4 ... primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL 9 µL 900 nM, 250 .... Last Update: July 7, 2023 Workflow Timeline Day 1: Seed and transduce cells Day 4: Treat cells with ...Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad, PX1 1–10 µL single channel pipette 20–200 µL single channel...TrypLE, Thermo Fisher, 12605010) Ethanol, VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10... each viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add...suspension well before seeding. Mix each well with a 1 mL pipette 5–10 times. The final volume in the well...

...(PPE) for BSL-1 and BSL-2 Labs Learn how to best protect yourself when working in BSL-1 and BSL-2 labs...Levels One and Two (BSL-1 and BSL-2) Safety measures for laboratories operating at BSL-1 and BSL-2 Watch the... T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols for using the pLKO.1 vector, a backbone used...Introductory techniques designed to help you get started in the lab. Name Description (Link opens in a new...gel Watch the Video! How to Design a Primer Key considerations when designing primers Watch the Video! Sequence...blocks for many more complicated procedures. Name Description (Link opens in a new window) Link to Video Making...constructing and analyzing your plasmids. Name Description (Link opens in a new window) Link to Video Restriction...

...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest...for it to then be digested and ligated into your desired plasmid. It is important to note that restriction...enzymes that cut your insert or backbone at only the desired location for your cloning project. Restriction ...rapidly shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase...bacterial recombination to easily move it into any destination plasmid that fits your experimental goal. Although... Gateway donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection...Any dsDNA fragments can be used, so if properly designed, any insert fragment (PCR product or synthesized...

...Prepare the chemiluminescence substrate by mixing 1:1 reagent A to reagent B. Gently incubate the membrane...Last Update: January 24, 2022 Workflow Timeline Day 1: Prepare lysates, run SDS-PAGE, transfer, block, incubate...primary antibodies raised in a mouse. Procedure Section 1: Lyse cells Centrifuge 5 x 10 6 cells for 5 min at...Gently remove supernatant. Resuspend cell pellet in 1 mL of 1X PBS and transfer to a microcentrifuge tube...preferred method for protein determination. Prepare a 50:1 Reagent A to Reagent B dilution of the BCA assay. ...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... vary between antibodies but is typically between 1–10 μg/mL. Incubate the membrane overnight in primary...

...dilution Dilution 1 (DNase step) 5 uL AAV stock 45 uL 10X 10X Dilution 2 5 uL Dil. 1 95 uL 20X 200X Dilution...range from 1 x 10 12 GC/mL to >2 x 10 13 GC/mL and we use an internal reference virus that is 1 x 10 13 ...Equipment qPCR instrument Heating plate Pipettors 1–10 µL single channel pipette 20–200 µL single channel...channel pipette 200–1000 µL single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette...The reference material should have a titer within 1-log of the expected titer of the samples being tested...Amount for ONE Reaction Amount for 100 reactions (1 x 96 well plate) Universal SYBR Master Mix 2X 10 μL...mole)/bp = 4.03 x 10 6 g/mole Moles/μl: 1.07 μg/μL x 1 g/10 6 μg x1 / 4.03 x 10 6 g/mole = 2.65 x 10 -13 ...

...from 1:1 to 1:6. Add the diluted PEI-MAX to the diluted DNA. Cap the tube and vortex with three 1 s pulses...solution at -20 °C. 1 mg/mL PEI-MAX Add 1 g of PEI-MAX powder to 900 mL deionized water in a 1 L bottle and ...to mix. Add 450 µL of 1 mg/mL PEI-MAX to the second tube of 6 mL BCD TFX (for a 1 mg/mL stock solution ...Last Update: February 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells... a time. Add deionized water to a final volume of 1 L and recheck pH to ensure that it has not drifted...Aliquot and freeze upright at -20 °C. Procedure Section 1: Seeding cells The day prior to transfecting, seed...of two 50 mL tubes. Cap the tubes and incubate for 1 h in the 37 °C bead bath. Transfer the PEI-MAX and...

...Preparation 1 M NaCl/PBS-MK buffer Dissolve 5.84 g of NaCl, 26.3 mg of MgCl 2 and 14.91 mg of KCl in 1× PBS ...gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer exchange and concentration Note...Dissolve 26.3 mg of MgCl 2 , and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing... step: mix 4.5 mL of 60% iodixanol and 13.5 mL of 1 M NaCl/PBS-MK buffer 25% iodixanol step: mix 5 mL ...Hamilton needle, taking care to avoid bubbles (Figure 1). 8 mL of 15% iodixanol step 5 mL of 25% iodixanol...disturb the gradient!** Collect Fractions Option #1 Prepare a row of roughly 20 open 1.5 mL microcentrifuge...with a 16 ga needle and start collecting 0.5 mL to 1 mL fractions per tube. Avoid the proteinaceous material...