Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 862 results for: LIC

Showing: 851 - 862 of 862 results

  1. CRISPR Guide

    Type
    Guide
    ...Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an interesting... every genomic target. Due to its comparative simplicity and adaptability, CRISPR rapidly became the most... to various Cas enzymes have extended CRISPR applications to increasingly complex functions, including...understanding of CRISPR biology, introduce the various applications of CRISPR, and help you get started using CRISPR... Cas12a, which are available for specialized applications. Check out our list of additional Cas proteins...genomic edits carried out by Cas9. Multiplexing applications include editing multiple genes at once; using...to help you select an optimized gRNA for your application (see: Plan Your Experiment ). In addition to ...

  2. Lentiviral Vector Guide

    Type
    Guide
    ... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery...of safety improvements and the potential for replication-competent lentivirus production — that is, creation...particles that could infect cells and further replicate on their own. While the viral components are still...Interchangeable; usually encodes for VSV-G Safety Safe; replication incompetent by using three separate plasmids ...plasmids encoding the necessary viral genes Safer; replication incompetent by using four plasmids instead of ...

  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery... for safety to reduce the chance of creating replication-competent retroviruses. For a summary of all ...retroviral vectors are commonly used in gene therapy applications to more specifically direct delivery of gene...vectors are a popular choice in gene therapy applications. There are many approved gamma-retroviral gene...cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors. Gamma-retroviral...vectors are: The potential for generation of replication-competent gamma-retroviral vectors The potential...

  4. Plan Your Experiment

    Type
    Guide
    ...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...gene you target will depend on your specific application. For example: To activate or repress a target...region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since ...validate your edit will depend upon your specific application. However, there are several common ways to verify...

  5. Addgene's eBook Collection

    Type
    Guide
    ...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...introductions and helpful tips for antibody-based applications, from flow to IHC! Close About Overlay 0 of ...

  6. Guide to Using Pooled Libraries

    Type
    Guide
    ..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...library screens, cells are infected at a very low multiplicity of infection (MOI) to increase the odds that...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...

  7. Sequencing Primers

    Type
    Guide
    ...promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG...reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of Rous sarcoma virus (RSV) env gene, forward...

  8. Chemogenetics Guide

    Type
    Guide
    ...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...chemogenetics for research and potential clinical applications. Science. 364(6436):eaav5282. PMID: 30872534...

  9. Optogenetics Guide

    Type
    Guide
    ...conformation/dimerization. In addition to the applications described above, both LOV and Dronpa can control...Arabidopsis thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~488 LOV domains...

  10. Educational Resources

    Type
    Guide
    ...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...

  11. Science Guides

    Type
    Guide
    ...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...

  12. Promoters

    Type
    Guide
    ...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
Showing: 851 - 862 of 862 results