We narrowed to 367 results for: Pol

...EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10 mg/mL, Millipore, TR-1003-G Molecular Biology... Pierceable foil heat seal, Bio-Rad, 1814040 Polystyrene reservoirs, VWR, 89094-662 Microcentrifuge tubes...300,000 cells/well in 1350 µL media and 11.1 µg/mL Polybrene into the wells containing the virus and the untransduced...,000 cells in 13.5 mL of media and 11.1 µg/mL Polybrene. Mix the cell suspension well before seeding. ...final volume in the well is 1.5 mL, and the final Polybrene concentration is 10 µg/mL. Mix well and incubate...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel...

...glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene (10mg/mL), Millipore TR-1003-G 1X PBS pH 7.4 without... the attachment of adherent cells) 0.45 μm polyethersulfone filter, Nalgene, 565-0010 (for viral preps... collected virus, filter through a 0.45 μm polyethersulfone filter to remove cells and debris. Lentiviral...lentivirus into DMEM complete containing 10 μg/mL polybrene. Note, this protocol was developed using low titer...Volume of DMEM complete (μL) Volume of 10mg/mL polybrene (μL) 1:10 150 1348.5 1.5 1:25 60 1438.5 1.5 1:...

...by heating to 56 °C for 30 minutes. 0.45 μm polyethersulfone (PES) filter system, Nalgene, 565-0010 (or... the attachment of adherent cells) 1 mg/mL Polyethylenimine (PEI) 25 kDa MW Pro-Tip Other transfection...100 Benzonase/DNAse I (Millipore 71205-3) 40% Polyethylene Glycol 8000 (PEG) + 0.5 M NaCl Cell lysis buffer...HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) solution: Dissolve 100 mg of PEI powder...discard the tube and thaw a new working stock. 40% POLYETHYLENE GLYCOL (PEG) 8000 solution: Dissolve 400 g of...

...plasmid using restriction enzymes Watch the Video! Polymerase Chain Reaction (PCR) Basic PCR protocol with ...cloning with Type II restriction enzymes and T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols...Lentivirus Production Produce lentivirus with a polyethyenimine (PEI) transfection protocol Fluorescence Titering...Dilution Generate monoclonal cell lines from a polyclonal pool of stable cells AAV Production in HEK293...

... transfecting mammalian cells using linear polyethylenimine. Transfections allow for transient expression... Thermo Fisher, 12309019 25 mM chloroquine Polyethylenimine, linear MW 25,000 Da Microcentrifuge tubes...Hydrochloric acid Sodium hydroxide 0.22 μm polyethersulfone (PES) filter Syringes for filtering Reagent...should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) Dissolve 100 mg...

...cells with recombinant antibody plasmids using Polyethylenimine Max as a transfection reagent. After transfection... acid sodium salt, Sigma Aldrich P4543-10G Polyethylenimine hydrochloride, M.W. 40000 (PEI-MAX), Linear...Linear, Transfection Grade, VWR 75800-188 10% Poloxamer 188, Thermo Fisher 24040032 Glutagro, Corning 25-...BCD TFX 1000 mL BalanCD HEK293 Media 10 mL 10% Poloxamer 188 40 mL 200 mM Glutagro Do not add selective...

... high fidelity taq polymerase to minimize mutations. The fidelity of the polymerase becomes more important...bp depending on the polymerase used. Because of this, no matter which taq polymerase you use, it is important...

...264 50 mL conical tubes, VWR 89039-656 96-well polyester (clear) microplate seal, Thermo Scientific 5701...76322-134 Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000...Desmin (blue) or a negative control protein, Apolipoprotein L3 (red) overnight, blocked, and incubated ...

...a blunt end ligation. Use T4 DNA Polymerase or Klenow DNA Polymerase I for 3′ overhang removal and 5′ ...

...pipette Reagents 1X PBS Microcentrifuge tubes Sterile Poly-D-lysine coated coverslips HeLa cells 24-well plate...Procedure Section 1: Seeding cells Place a sterile poly-D-lysine coated coverslip in each well of a 24-well...

...Primers How to Design a Primer You may also like... Polymerase Chain Reaction Plasmid Cloning by PCR Agarose...

...anneal to each other. Phusion High-Fidelity DNA Polymerase - incorporates nucleotides to “fill in” the gaps...

...for visualizing very short DNA fragments is polyacrylamide gel electrophoresis (PAGE), which is typically...

... master mix which contains a high-quality DNA polymerase and a blend of dTTP/dUTP to minimize carryover...

...software. The sample is separated by denaturing polyacrylamide gel electrophoresis alongside serial dilutions...

...BSA standard concentration versus absorbance. Extrapolate the total protein concentration of the sample...

...RNase free tubes: microcentrifuge tubes, 4 mL polypropylene tubes RNase decontamination solution like RNase...

...they control the binding of the RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA, which is ... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA polymerase lac Constitutive... and contains the RNA polymerase binding site, TATA box, and TSS. RNA polymerase will stably bind to this...systems Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes... is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during ...

...vector Forward Polyhedrin forward AAATGATAACCATCTCGC Polyhedrin promoter Forward Polyhedrin reverse GTCCAAGTTTCCCTG...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end...DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...GTCCAAGTTTCCCTG For baculovirus vector with polyhedrin promoter Reverse pQE promoter CCCGAAAAGTGCCACCTG ...promoter Forward SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter...Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon...

...exonuclease activity of T4 DNA polymerase. In LIC, the T4 DNA polymerase’s exonuclease activity creates ...and thymine (T). TOPO cloning utilizes the Taq polymerase, which naturally leaves a single A overhang on...Additionally, the efficiency can vary depending on the polymerase used, and the single A overhangs degrade over...common molecular biology enzymes: 5' exonuclease, polymerase, and ligase. In Gibson assembly, DNA fragments...each other due to their homology. Second, DNA polymerase then closes the gap created by the 5’ exonuclease...reaction. In the presence of a single free dNTP, T4 polymerase will continue to function as an exonuclease until...complementary to the free nucleotide. T4 will resume its polymerase activity, add back the free base, and become ...