Skip to main content

We narrowed to 368 results for: Pol

Showing: 341 - 360 of 368 results
  1. AAV ddPCR Titration

    Type
    Protocol
    ...Supermix for Probes no dUTP, Bio-Rad,1863023 10% Poloxamer 188, Thermo Fisher, 24040032 Droplet generation...1814040 Microseal adhesive seal, Bio-Rad, MSB1001 Polystyrene Reservoirs, VWR, 89094-662 Microcentrifuge tubes...Reagent Preparation 1X PCR Buffer containing 0.05% Poloxamer 188: Prepare immediately before use and vortex...using. 500 µL of GeneAmp 10X Buffer 25 µL of 10% Poloxamer 188 4475 µL Molecular Biology Grade Water Procedure... the NTC. Pour the 1X dilution buffer into a polystyrene reagent reservoir. Using a 20–200 µL multichannel...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel...
  2. Lentivirus ddPCR Titration

    Type
    Protocol
    ...EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10 mg/mL, Millipore, TR-1003-G Molecular Biology... Pierceable foil heat seal, Bio-Rad, 1814040 Polystyrene reservoirs, VWR, 89094-662 Microcentrifuge tubes...300,000 cells/well in 1350 µL media and 11.1 µg/mL Polybrene into the wells containing the virus and the untransduced...,000 cells in 13.5 mL of media and 11.1 µg/mL Polybrene. Mix the cell suspension well before seeding. ...final volume in the well is 1.5 mL, and the final Polybrene concentration is 10 µg/mL. Mix well and incubate...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel...
  3. Fluorescence Titering Assay

    Type
    Protocol
    ...glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene (10mg/mL), Millipore TR-1003-G 1X PBS pH 7.4 without... the attachment of adherent cells) 0.45 μm polyethersulfone filter, Nalgene, 565-0010 (for viral preps... collected virus, filter through a 0.45 μm polyethersulfone filter to remove cells and debris. Lentiviral...lentivirus into DMEM complete containing 10 μg/mL polybrene. Note, this protocol was developed using low titer...Volume of DMEM complete (μL) Volume of 10mg/mL polybrene (μL) 1:10 150 1348.5 1.5 1:25 60 1438.5 1.5 1:...
  4. AAV Production in HEK293 Cells

    Type
    Protocol
    ...by heating to 56 °C for 30 minutes. 0.45 μm polyethersulfone (PES) filter system, Nalgene, 565-0010 (or... the attachment of adherent cells) 1 mg/mL Polyethylenimine (PEI) 25 kDa MW Pro-Tip Other transfection...100 Benzonase/DNAse I (Millipore 71205-3) 40% Polyethylene Glycol 8000 (PEG) + 0.5 M NaCl Cell lysis buffer...HEPES to 750 mL DMEM + 1 g/L glucose. 1 mg/mL polyethylenimine (PEI) solution: Dissolve 100 mg of PEI powder...discard the tube and thaw a new working stock. 40% POLYETHYLENE GLYCOL (PEG) 8000 solution: Dissolve 400 g of...
  5. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ...plasmid using restriction enzymes Watch the Video! Polymerase Chain Reaction (PCR) Basic PCR protocol with ...cloning with Type II restriction enzymes and T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols...Lentivirus Production Produce lentivirus with a polyethyenimine (PEI) transfection protocol Fluorescence Titering...Dilution Generate monoclonal cell lines from a polyclonal pool of stable cells AAV Production in HEK293...
  6. General Transfection

    Type
    Protocol
    ... transfecting mammalian cells using linear polyethylenimine. Transfections allow for transient expression... Thermo Fisher, 12309019 25 mM chloroquine Polyethylenimine, linear MW 25,000 Da Microcentrifuge tubes...Hydrochloric acid Sodium hydroxide 0.22 μm polyethersulfone (PES) filter Syringes for filtering Reagent...should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) Dissolve 100 mg...
  7. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...cells with recombinant antibody plasmids using Polyethylenimine Max as a transfection reagent. After transfection... acid sodium salt, Sigma Aldrich P4543-10G Polyethylenimine hydrochloride, M.W. 40000 (PEI-MAX), Linear...Linear, Transfection Grade, VWR 75800-188 10% Poloxamer 188, Thermo Fisher 24040032 Glutagro, Corning 25-...BCD TFX 1000 mL BalanCD HEK293 Media 10 mL 10% Poloxamer 188 40 mL 200 mM Glutagro Do not add selective...
  8. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ... high fidelity taq polymerase to minimize mutations. The fidelity of the polymerase becomes more important...bp depending on the polymerase used. Because of this, no matter which taq polymerase you use, it is important...
  9. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...264 50 mL conical tubes, VWR 89039-656 96-well polyester (clear) microplate seal, Thermo Scientific 5701...76322-134 Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000...Desmin (blue) or a negative control protein, Apolipoprotein L3 (red) overnight, blocked, and incubated ...
  10. Immunocytochemistry

    Type
    Protocol
    ...pipette Reagents 1X PBS Microcentrifuge tubes Sterile Poly-D-lysine coated coverslips HeLa cells 24-well plate...Procedure Section 1: Seeding cells Place a sterile poly-D-lysine coated coverslip in each well of a 24-well...
  11. Protocol - How to Design Primers

    Type
    Protocol
    ...Primers How to Design a Primer You may also like... Polymerase Chain Reaction Plasmid Cloning by PCR Agarose...
  12. Gibson Assembly Protocol

    Type
    Protocol
    ...anneal to each other. Phusion High-Fidelity DNA Polymerase - incorporates nucleotides to “fill in” the gaps...
  13. Western Blot

    Type
    Protocol
    ...BSA standard concentration versus absorbance. Extrapolate the total protein concentration of the sample...
  14. Kit Free RNA Extraction

    Type
    Protocol
    ...RNase free tubes: microcentrifuge tubes, 4 mL polypropylene tubes RNase decontamination solution like RNase...
  15. Promoters

    Type
    Guide
    ...they control the binding of the RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA, which is ... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA polymerase lac Constitutive... and contains the RNA polymerase binding site, TATA box, and TSS. RNA polymerase will stably bind to this...systems Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes... is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during ...
  16. Sequencing Primers

    Type
    Guide
    ...vector Forward Polyhedrin forward AAATGATAACCATCTCGC Polyhedrin promoter Forward Polyhedrin reverse GTCCAAGTTTCCCTG...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end...DsRed1 Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...GTCCAAGTTTCCCTG For baculovirus vector with polyhedrin promoter Reverse pQE promoter CCCGAAAAGTGCCACCTG ...promoter Forward SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter...Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon...
Showing: 341 - 360 of 368 results