...plasmid using restriction enzymes Watch the Video! Polymerase Chain Reaction (PCR) Basic PCR protocol with ...cloning with Type II restriction enzymes and T4 polymerase pLKO.1 - TRC Cloning Vector Cloning protocols...Lentivirus Production Produce lentivirus with a polyethyenimine (PEI) transfection protocol Fluorescence Titering...Dilution Generate monoclonal cell lines from a polyclonal pool of stable cells AAV Production in HEK293...

... transfecting mammalian cells using linear polyethylenimine. Transfections allow for transient expression... Thermo Fisher, 12309019 25 mM chloroquine Polyethylenimine, linear MW 25,000 Da Microcentrifuge tubes...Hydrochloric acid Sodium hydroxide 0.22 μm polyethersulfone (PES) filter Syringes for filtering Reagent...should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) Dissolve 100 mg...

... high fidelity taq polymerase to minimize mutations. The fidelity of the polymerase becomes more important...bp depending on the polymerase used. Because of this, no matter which taq polymerase you use, it is important...

...because they control the binding of RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately... factors in order for RNA polymerase II (a eukaryote-specific RNA polymerase) to bind to a promoter. Transcription...the RNA polymerase binding site, TATA box, and transcription start site (TSS). RNA polymerase will bind...binding of the RNA polymerase. A transcription complex is constructed from the RNA polymerase and several transcription...T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires Sp6 RNA polymerase Promoter...and trp Types of RNA Polymerases Promoters control the binding of RNA polymerase to DNA to initiate the...three types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes...

...and thymine (T). TOPO® cloning utilizes the Taq polymerase which naturally leaves a single adenosine (A)...Additionally, the efficiency can vary depending on the polymerase used, and the single A overhangs degrade over...common molecular biology enzymes: 5' exonuclease, polymerase and ligase. 5' exonuclease digests the 5' end...to generate 3' single-stranded overhangs. DNA polymerases synthesize DNA molecules using the 4 nucleotides...anneal to each other due to their homology. DNA polymerase then closes the gap created by the 5’ exonuclease...relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme which removes nucleotides... the end of a DNA strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs...

...264 50 mL conical tubes, VWR 89039-656 96-well polyester (clear) microplate seal, Thermo Scientific 5701...76322-134 Pipettes, 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000...Desmin (blue) or a negative control protein, Apolipoprotein L3 (red) overnight, blocked, and incubated ...

...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC... Reverse GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40...primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial...

...1814040 Microseal adhesive seal, Bio-Rad, MSB1001 Polystyrene Reservoirs, VWR, 89094-662 Microcentrifuge tubes... the NTC. Pour the 1X dilution buffer into a polystyrene reagent reservoir. Using a 20–200 µL multichannel...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel...

...lower background signals than polyclonal antibodies. However, polyclonal antibodies are more sensitive...clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that are specific... antibodies are typically more expensive than polyclonal antibodies. Environmental factors, binding partners...available epitope on your protein of interest. Polyclonal antibodies are typically collected directly from...targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally stable...protein in any form it may be present in. However, polyclonals can vary significantly from lot to lot, as immune...consider the following questions: Do you need polyclonal or monoclonal antibodies? Will you be using a...

...optogenetics tool - they typically allow the fast depolarization of neurons upon exposure to light through direct... trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic toolbox has been...light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements include..., Chrimson, ChrimsonR, Chronos Inhibitory (Hyperpolarizing) ChR Variants. Alternatively, ChR variants ...chloride channels, these variants result in the hyperpolarization of neurons. Examples of anion channel variants...NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition) of the cell when triggered with... a light-activated outward proton pump that hyperpolarizes (inhibits) the cell when triggered by green-yellow...

...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates.... During replication, DNA unwinds and the DNA polymerase enzyme binds to and migrates down the single ...replication requires the 4 nucleotides, a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro one...

...a blunt end ligation. Use T4 DNA Polymerase or Klenow DNA Polymerase I for 3′ overhang removal and 5′ ...

...pipette Reagents 1X PBS Microcentrifuge tubes Sterile Poly-D-lysine coated coverslips HeLa cells 24-well plate...Procedure Section 1: Seeding cells Place a sterile poly-D-lysine coated coverslip in each well of a 24-well...

...cells with recombinant antibody plasmids using Polyethylenimine Max as a transfection reagent. After transfection... acid sodium salt, Sigma Aldrich P4543-10G Polyethylenimine hydrochloride, M.W. 40000 (PEI-MAX), Linear...

...Primers How to Design a Primer You may also like... Polymerase Chain Reaction Plasmid Cloning by PCR Agarose...

...anneal to each other. Phusion High-Fidelity DNA Polymerase - incorporates nucleotides to “fill in” the gaps...

...for visualizing very short DNA fragments is polyacrylamide gel electrophoresis (PAGE), which is typically...

... master mix which contains a high-quality DNA polymerase and a blend of dTTP/dUTP to minimize carryover...

...software. The sample is separated by denaturing polyacrylamide gel electrophoresis alongside serial dilutions...

...BSA standard concentration versus absorbance. Extrapolate the total protein concentration of the sample...