...pmTurquoise2-NES Non-nucleus Nuclear Export Sequence mTurquoise2 Dorus Gadella 85062 pmScarlet-i_NES_C1 Non-nucleus...pmScarlet-H_NES_C1 Non-nucleus Nuclear Export Sequence mScarlet-H Dorus Gadella 85060 pmScarlet_NES_C1 Non-...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization ...Localization More Fluorescent Protein Resources: Empty Backbones Allen Institute for Cell Science Plasmid Collection...proteins that enter the secretory pathway require chaperones to help with folding or post-translational modification...

...Li Norepinephrine nLight red and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring...Norepinephrine GRAB_NE family of GPCR activation-based NE sensors A Genetically Encoded Fluorescent Sensor ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...Campbell Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins...proteins Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent...mScarlet-based calcium sensor with exceptional brightness, photostability, and multiplexing capabilities...

...Knockout Screening in Human Cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl...and easily manipulate specific genes. But what if you want to study genes all across the genome? Two new...screen for genes involved in bacterial toxin resistance, identifying 4 previously unknown genes.  “With ...library, which they call GeCKO, targets 18,080 human genes with 64,751 unique guide sequences to enable both...including Feng Zhang used the GeCKO library to identify genes essential for cell viability in cancer and pluripotent...In a melanoma model, they also went in search of genes involved in resistance to the cancer drug vemurafenib...guide RNAs (gRNAs) covering a total of 7,114 human genes. Unlike the GeCKO library, each library has been...

...expressing nLightG or nLightR before/after application of NE (10 μM) and corresponding pixel-wise ΔF/F0 heatmaps... expression of the indicators over white dashed lines. Scale bars, 10 μm (HEK293T), 20 μm (neurons). Figure...options for multiplexing in experiments, including ones that study alpha2-AR. Selectivity Norepinephrine...

...Feb;10(4):337-47. PubMed PMID: 12595892. 4. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide...virus can be used to generate Cas9-expressing cell lines, which can then be used both for screens (using ...

...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nature Methods. 2014 Aug;11(8.... After the monoclonal lines have been sufficiently expanded, screen the lines for transgene expression...transgene expression over time, as the lower expressing clones take over the polyclonal cell pool. Generating ...details, see our protocol for generating stable cell lines with lentivirus . Day 0: (optional) Seed cells for... cells Day 14–30: Analyze and expand monoclonal lines of interest Equipment Class II, Type A2 Biological...Heat-inactivated FBS 1X PBS pH 7.4 without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment...pool: see our protocol for generating stable cell lines with lentivirus . Pro-Tip Because the polyclonal...

...Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, Sanjana NE, Zhang F (2017) Genome-scale CRISPR-Cas9 knockout...available reference sequence or plasmids containing genes with many modifications. We look for point mutations...

...specific genes using dCas9-VP64 activator fragments (dCas9(C)-FKBP-2xNLS-VP64 and dCas9(N)-FRB-NES). This...FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting in a rapamycin-inducible Cas9 for genome...editing. Without rapamycin treatment, the Cas9(N)-FRB-NES fragment is actively shuttled out of the nucleus ...sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and net influx...of downstream genes. Nihongaki et al describe the targeted activation of endogenous genes and detail the... promoter-less Gateway® entry clones to be used with other entry clones encoding the ORFs of interest:...neuron-like” phenotype when targeting genes involved in neurogenesis, which had proven challenging using...

...Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, Sanjana NE, Zhang F. Genome-scale CRISPR-Cas9 knockout and transcriptional...

...beta-hydroxylase (DBH, magenta) to label norepinephrine (NE) expressing neurons and GFP (green) to label neurons...’m willing to bet the answer would be along the lines of “we have a lot”. In fact, scientists often cite..., C. M., Leib, R. D., Cirolia, G., Thomas, D., Stamnes, S., Holt, K., Sinn, P., May, A. P., & Paulk, N...availability upon request differ across scientific disciplines. Scientific Data, 8(1), 1–11. https://doi.org...

...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783...2nd-generation lentiviral system (Figure 2). The HIV genes that do remain are very important for viral production...make stable transgene-expressing or knockout cell lines. Many CRISPR plasmids are designed for lentiviral...integrate into the genome, they could promote oncogenesis by altering local gene expression. Self-inactivating...LTR that prevents aberrant activation of nearby genes. These safer vectors have become standard in gene...

...doi.org/10.1089/hum.2019.277 Lavin TK, Jin L, Lea NE, Wickersham IR (2020) Monosynaptic Tracing Success...used different scrambled sequences to flank the transgenes (non-homologous pairs) (Figure 2.). They found...

...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783...cells were then used to generate a monoclonal cell lines by limiting dilution. The rest of the cells were... you’re doing a screen. I made a few monoclonal lines (Figure 2) and I was surprised at how variable Cas9... Figure 2: Cas9 expression in monoclonal cell lines generated from A549 cells transduced with lentiCas9...results. (Figure 5). The digestion product (Figure 4, lanes 0.3 % 3.0, Figure 5, lane 2) is faint, so comparing...formed from control (GFP gRNA-targeted) BRAF sites (lanes 3, 4) were used as controls. Duplexes were generated...Resources at Addgene.org Generating Stable Cell Lines with Lentivirus Isolating a Monoclonal Cell Population...

...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...

...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...none S. pyogenes Gersbach pUC57-sgRNA expression vector 51132 Mammalian BsaI none S. pyogenes Huang pAC154... yes, activate S. pyogenes Jaenisch pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen...

... aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31...snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen 50580 pBUN6I11...yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen 50594 pCBC-MT2T3... paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4 see paper BsaI none S. pyogenes Chen 62204 pBUN421 ...TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3-gRNA ...gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA Arabidopsis...Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411 OsU3 yes, cut S. pyogenes Basta Chen 62203 pHUE411...

...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi... and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified. You can therefore...CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications... ability to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live...Multiplexing applications include editing multiple genes at once; using dual nickases to generate a knockout... used to knock out, activate, or repress target genes when paired with the appropriate Cas enzyme. Specific...CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most popular Cas endonuclease, with many...

...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...and 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin... in backbone XPR_502 (P65 HSF) targeting 18,885 genes and containing 56,762 unique sgRNAs. This backbone...

...AAV-EF1a-BbTagBY Control Joshua Sanes AV-9-PV2454 45186-AAV9 AAV-EF1a-BbChT Control Joshua Sanes AV-9-PV2629 100043...Looger, Eric Schreiter AV-1-PV3844 100855-AAV1 pAAV.CAG.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas...Douglas Kim AV-1-PV3845 100856-AAV1 pAAV.Syn.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1...-1-PV3846 100857-AAV1 pAAV.Syn.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3847 100852-...100852-AAV1 pAAV.CAG.Flex.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3848 100853-AAV1 pAAV....Biosensor GENIE, Douglas Kim AV-1-PV3849 100854-AAV1 pAAV.Syn.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas ...Douglas Kim AV-1-PV3850 100849-AAV1 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3851...

...Double‐Readout Lu minescence‐based T wo‐ Hy brid) : Combines in vivo BRET with ex vivo luminescence-based co-immunoprecipitation...Luciferase Blog: Luminescent Imaging with Nano-lanterns Collection Highlights Empty Backbones Expression Constructs... DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based protein-protein...for assays of transcriptional regulation and bioluminescent reporters. Plasmid...Luciferase is the enzyme responsible for the bioluminescence found in a diverse number of organisms, ranging...delivered intracellularly in order to measure luminescence. Gaussia luciferase is secreted and more stable...time course experiments possible, but its short luminescence half-life makes it too dim for many experimental...

...FRET More Fluorescent Protein Resources: Empty Backbones Biosensors Subcellular localization Optogenetics...biosensors targeting small molecules or specific genes are also available. Custom biosensors can also ... linker-Venus-6aa linker-Venus V5V Anisotropy/brightness standard consisting of two Venus fluorescent ...connected via a 5 amino acid linker V17V Anisotropy/brightness standard consisting of two Venus fluorescent ...connected via a 17 amino acid linker V32V Anisotropy/brightness standard consisting of two Venus fluorescent ...connected via a 32 amino acid linker VVV Anisotropy/brightness standard consisting of three Venus fluorescent...amino acid linker, respectively VVVV Anisotropy/brightness standard consisting of four Venus fluorescent...

...developmental biology. With its rapid development (embryogenesis is complete in ~3 days), short generation time...research model. With more than 70% of human disease genes having an ortholog in zebrafish, this species has...This includes plasmids for genome editing, empty backbones, fluorescent proteins, reporters, biosensors, ...selection of plasmids expressing Cas9 and empty gRNA backbones. A few examples of useful zebrafish CRISPR resources...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9...with fluorescent proteins to visualize and track clones of cells over time. Examples of useful tools for...cassettes encoding fluorescent proteins for tagging genes at endogenous genomic loci in zebrafish. NTR 2.0...

...Protocol for Genomic Deletions in Mammalian Cell Lines CasPEDIA : An encyclopedia of Class 2 CRISPR systems... and quantify the efficiency of the targeted mutagenesis The amplicon sequence expected after HDR can ...identify positively or negatively selected sgRNAs, genes, or pathways. CrispyCrunch CrispyCrunch is used ...CRISPR screens targeting a long or short list of genes provided by the user. Read more about it on the ...tool that identifies putative target sites for S. pyogenes Cas9, S. thermophilus Cas9, or Cpf from your input...Arabidopsis, C. elegans , sea squirt, cavefish, Chinese hamster, fruit fly, human, rice fish, mouse, silk...mouse, rat, chicken, frog, zebrafish, fly, worm, Japanese rice fish, maize, Arabidopsis, and rice. Proof-of-concept...

...Caenorhabditis elegans. Mos1 Based Transgenesis miniMos Transgenesis Kit - Erik Jorgensen Lab. This kit...development, and aging. Scientists can knock down genes by feeding worms bacteria expressing dsRNA or use...editing to easily engineer specific transgenic worm lines. The transparent body of the C. elegans hermaphrodite...worm research. This includes CRISPR, RNAi, empty backbones, fluorescent proteins, and Cre expression plasmids...Description Gene/Insert PI Plasmids Expressing Worm Genes/Inserts The table below lists plasmids that contain... include plasmids expressing Cas9, empty gRNA backbones, and constructs for endogenous tagging. Some examples...Jorgensen Lab. A collection of plasmids that streamlines the production of targeting vectors for tag insertion...

...pluripotent stem cell (hiPSC) lines. The plasmids used to generate these lines have been deposited here with...from the hiPS cell lines gRNA sequences used in the creation of the hiPS cell lines The following plasmids...proteins of key cellular structures in human cell lines. Depositor...proteins of key cellular structures in human cell lines of their choice. For a full description of how to...plasmids can be used to create cell lines with endogenously-tagged cellular structures. Addgene ID Plasmid...HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin...nuclear antigen (PCNA) DNA replication foci IPSC cell lines can be ordered from the Allen Institute for Cell...

...Gene Switch: These constructs contain two genes of interest, Genes A and B. When Cre is absent, only Gene...the orientation and location of the loxP sites determines how the genetic material will be rearranged. ...have developed constructs to activate/inactivate genes when Cre is present. By expressing Cre at specific...regulation. Promoter-regulated Cre: The promoter region defines the areas in which Cre will be expressed. Cre may... Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler 68552 HRE:GFP-pGK:Cre Cre and hypoxia-responsive...orientation, and type of target sites that flox your genes of interest makes FLEx switch a powerful experimental...genOway press release for more information. Empty backbones to regulate your gene of interest: ID Plasmid ...

...Over time, a loss of motor neurons leads to limb weakness, difficulty speaking, swallowing and breathing...mechanisms are still poorly understood but several genes and mapped loci seem to be associated with the disease...known genetic mutations in one of the following genes: SOD1, C9ORF72, TARDBP, FUS and OPTN. Huntington's... a mutation in one of three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority... are a risk factor for late-onset AD. Many more genes have been associated with Alzheimer's disease, through...now investigating the role that these additional genes may play in Alzheimer's disease. Research Tools ...type or mutant ORFs, gene fragments, and gRNAs for genes linked to neurodegenerative disorders. Find plasmids...

...Institute: Patient-specific lines (Link opens in a new window) RSRT iPSC lines and isogenic controls , patient-specific... Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens ...global transcriptional regulator of thousands of genes and studies have suggested roles in transcriptional...almost 46% of all Rett syndrome cases. Research Milestones 1992 - MECP2 is discovered by Adrian Bird's lab...new window) PMID: 21074045 2017 - the Bird lab determines a minimally functional MECP2 that rescues neurological...opens in a new window) Envigo. The following cell lines are available directly from the labs in which they..., please email [email protected] The following cell lines are available directly from the labs in which they...

...top Empty Backbones The table below highlights plasmids that can be used as empty backbones for your gene...CRISPR Cloning Transcription Factors RNAi Empty Backbones Fluorescent Proteins Other Resources Background...different functional variants of Cas9 and empty gRNA backbones. A few examples of useful plant CRISPR resources...includes CRISPR/Cas nucleases, base editors, gRNA backbones, and promoters for expression in monocots and ...CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes Stuttmann. Combined fluorescent seed selection...hierarchical assembly of plant multigene constructs - Johannes Stuttmann. MoChlo: Modular Cloning Chloroplast...highlights plasmids that feature fluorescent or luminescent proteins for expression in plants. You can search...

...repeat cycles of expansion. Chemokines Chemokines, or chemotactic cytokines, are small proteins that can...factor FLJ40431 Return to top Chemokines Chemokines, or chemotactic cytokines, are small proteins that can...sites of inflammation throughout the body. Cytokines Cytokines are molecules that enable cells of the immune...motif) receptor 1 CCXCR1, GPR5 Return to top Cytokines Cytokines are molecules that enable cells of the immune...Addgene’s immunology collection contains plasmids for genes involved in innate and adaptive immune signaling...response. Browse Plasmids for Immunology Research Genes have been grouped into tables based on the Gene ...plasmids for each gene. Please note that not all genes have plasmids available for request. Antigen Presentation...

...perspective, sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome...collection contains a variety of tools to help you harness bacterial genomes for your research. Plasmid ID...inducible expression of wild-type Cas9 from S. pyogenes for inducing double stranded breaks. For a more... Visualization Technique/Tag PI Purpose Empty Backbones with Fluorescent protein tags Various Plasmids... associated transcription factors, and reporter genes. pCS-PesaRlux 47640 PesaR 3OC6HSL (Quorum sensing...expression of catalytically inactive Cas9 ( S. pyogenes ) which can be combined with expression of a gRNA... Plasmids containing easily measurable reporter genes (eg. LacZ or Fluorescent Proteins ) under the control...

...performs a chemiluminescent reaction in the presence of several different substrates. The luminescence produced...Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into plasmids. Plasmids...region is a stable part of the antibody, which determines the isotype of the antibody. B cells, the immune...tears, saliva, mucus) where it protects mucosal membranes Dimer with a valency of 4 IgA1; IgA2 IgD Coexpressed... epitope, or polyclonal, meaning there are many clones that are specific to multiple epitopes on one antigen...Sodium azide, an antimicrobial agent, can block some amines needed for conjugation reactions and should be ... tubulin (sometimes referred to as housekeeping genes). This allows for relative comparison of expression...

...provides basic guidelines for working with various types of viruses; however, these guidelines may differ ...Plasmids | Guide Adenoviruses are commonly used as vaccines because of the strong immunogenic response they... to produce other molecules or to express other genes. Viruses used to direct these alternate functions...viruses) for safety through the removal of certain genes that are required for viral replication. Thus, as...that naturally occurring viruses do. Instead, the genes that are required for viral replication are usually...beginning virus work. For general virus biosafety guidelines, check out Addgene's Biosafety Resource Guide...

...top Plasmids Encoding Mammalian Genes or Inserts Several mammalian genes have been identified as having...to these genes below. ID Plasmid Description Industry PI For more information on these genes, see the ... is involved in beating of airway cilia.( 7 ) Cytokines - SARS-CoV-2 infection induces a cytokine storm...storm response in the body. For a full list of cytokines and related plasmids see our Immunology Resource...Spike Receptor Binding Domain Site-Saturation Mutagenesis Libraries - Libraries of variant Spike protein...

... identified that responded to stimuli, such as hormones or metal ions; however, these systems were confounded...On System In 1995, Gossen et al. used random mutagenesis to identify which amino acid residues of tetR...interest rtTA or TetR expression plasmid Stable cell lines can be made that continuously express a system component...tetracycline-free. Tetracycline-inducible Empty Backbones Find a construct that will allow you to insert...promoter, and Blasticidin; can be used to make cell lines Tet-On Advanced; Plasmid 26730 has hygro resistance...-69. PubMed . Transcriptional activation by tetracyclines in mammalian cells. Gossen M, Freundlieb S, ...

...Imaging More Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics Background...variants have been shown to have high effective brightness and allow for single or multicolor imaging. Photo-activatable...Vivo Imaging Far Red Protein Excitation/Emission Brightness Find Plasmids mCardinal 604/659 18 All mCardinal...Crimson Near-Infrared Protein Excitation/Emission Brightness Find Plasmids iRFP670 643/670 12.7 piRFP670-N1... Photoactivatable Protein Excitation/Emission Brightness Find Plasmids PAiRFP1 690/717 (after photoactivation...

...will promptly notify you by email within a few business days of your request to let you know that we don...solution. You must reply to that email within 10 business days in order to proceed with any adjustments ...analysis, you will be notified by email. If Addgene determines that our current queue is too high and we do ... will notify you by email before, or within 10 business days of ordering. We will give you the option ...solution. You must reply to this email within 10 business days in order to proceed with any adjustments ...

... discriminate between positive and negative clones. Clones with insertion will show only linearized plasmid...FAQs Can you summarize HR template vector design guidelines? A few notes below are considerations for designing...plasmid of ~8.5 kb (only AgeI will be able to cut). Clones without insertion will show a ~1kb and ~7.5kb fragment...) on each colony in order to screen for positive ones. - Or - If your HR template has a selection marker... primers that may work better than the published ones, so if/when you use HercII or Kapa Hifi the reaction...

...recombinase-expressing mouse lines 2–9 and combinations of transgenic recombinase-expressing animal lines and retro-grade...these ORF fragments (which have become exons) determines the logical expression requirements of Cre and...Flp-recombinase-expressing transgenic mouse and rat lines. The Fenno Lab maintains a public folder (Link opens...genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene ID Plasmid Logic Sites and...opens in a new window) Mandelbaum G, Taranda J, Haynes TM, Hochbaum DR, Huang KW, Hyun M, Umadevi Venkataraju...

...binding platform, to repress expression of arbitrary genes in bacteria or human cells ( Qi et al. ). This CRISPR...juxtaposed to the DNA complementary region. The uniqueness of CRISPRi, as compared to several recently published...applying the wild-type CRISPR system for genome mutagenesis ( Cong et al. , Mali et al. , Jiang et al. , ... could cause up to 300-fold repress on targeted genes. 2. Two-plasmid CRISPRi system for mammalian gene... up to 2~3-fold repress on targeted fluorescent genes. These plasmids are described in: Repurposing CRISPR...