Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 916 results for: Tro;

Showing: 51 - 100 of 916 results

  1. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type
    Blog Post
    ...for gene control over a 1,000-fold range. Weissman explained that there are two levels of control in the...technology has changed how scientists edit and control genes, but according to the Broad Institute's Silvana...screening In October, Jonathan Weissman’s lab introduced additional pooled CRISPR libraries, also available...abilities to turn genes on and off,” he said. “Some are strong and some more moderate; there is an allelic series...size of the backbone, transformations require electroporation. References & Further Reading: For more ...Epub 2014 Dec 10. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Gilbert LA, ...

  2. The Pleiades Promoter Project

    Type
    Collection
    ...CARTPT pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24...CCKBR pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27...CCL27 pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30...CLDN5 pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36...ICMT pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125... pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS ...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS...

  3. Caltech Systemic Capsids

    Type
    Collection
    ...undergo quality control, including AAV titering by probe-based droplet digital PCR, in vitro and (when possible...#103005) . Note on PHP.eB tropism and specific mouse lines: Enhanced CNS tropism exhibited by the PHP.eB...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...pAAV-CAG-GFP CAG GFP Control Boyden 50465 pAAV-hSyn-EGFP hSyn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP...pAAV-CaMKIIa-EGFP CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...-Fishell-1 Dlx GFP Control Fishell 99130 pAAV-mDlx-NLS-mRuby2 Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP...pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH...

  4. Brain Initiative Collection

    Type
    Collection
    ...in forebrain GABA-ergic interneurons under the control of the hDlx enhancer element Gordon Fishell 83894...in forebrain GABA-ergic interneurons under the control of the hDlx enhancer element Gordon Fishell 83895...

  5. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng....LacZ.bGH Control James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. ...eGFP.WPRE.rBG Control James M. Wilson AV-1-PV1963 105542-AAV1 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control James M....pENN.AAV.CMVs.TurboRFP.WPRE.RBG Control James M. Wilson AV-1-PV2642 105552-AAV1 pENN.AAV.hSyn.TurboRFP.WPRE.RBG Control James M...eYFP.WPRE.hGH Control Karl Deisseroth AV-1-PV3248 105557-AAV1 pENN.AAV.CB7.CI.mCerulean.WPRE.RBG Control James....SV40 Control Loren Looger AV-1-PV3661 98927-AAV1 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 Control Loren ....EGFP.WPRE.bGH Control James M. Wilson AV-2-27056 27056-AAV2 pAAV-Ef1a-DIO EYFP Control Karl Deisseroth...

  6. Plasmids for Stem Cell Research

    Type
    Collection
    ...Single polycistronic lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral...Minicircle Human Non-integrating mini-intronic plasmid (MIP) polycistronic expression of human Oct4, Klf4, ...MMLV-derived Retrovirus Human Yamanaka factors for generating human iPS cells; retroviral expression of...MMLV-derived Retrovirus Mouse Original set of Yamanaka factors for generating mouse iPS cells; retroviral expression...30. Zhou Astrocytes Dopaminergic Neurons Lentiviral Human Efficient conversion of astrocytes to functional...Fibroblasts Astrocytes Lentiviral Mouse Direct conversion of fibroblasts into functional astrocytes by defined...27(5):1042-9. Townes Lentivirus Human Single polycistronic lentiviral vector for the expression of human...

  7. Cre-lox system

    Type
    Collection
    ...Cepko CL. 2007. Controlled Expression of Transgenes Introduced by In Vivo Electroporation. Proc Natl Acad...pLOX-CW-CRE Cre CMV Lentiviral Trono 12265 pHR-CMV-nlsCRE Cre CMV Lentiviral Trono 12493 p259 pCMV-CRE-M (BglII...Tamoxifen inducible Retroviral Jacks 24064 MSCV-Cre Cre and EGFP coexpression Retroviral Littman 24333 ins-cre_cryaa-Venus...inducible PGK Retroviral Lowe 33342 LGmCreER (non-self deleting) Cre-ERT2 PGK Retroviral Lowe 33344 pLEW100cre-EP1...pMSCVpuro-Cre Cre 5'LTR Retroviral Ge 34565 pMSCVhygro-Cre Cre and HygroR coexpression Retroviral Ge 34568 WZLneo-Cre...GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG Retroviral Gage 49056 AAV-GFP/...AAV Deisseroth 59701 pRetroQ-Cre-ERT2 Cre-ERT2 -Tamoxifen inducible cmvIE Retroviral Youle 59720 Nanog-CreER...

  8. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...pSNAPf-Cox8A Control Plasmid SNAP-tag Control for mitochondrial localization 101124 pSNAPf-H2B Control Plasmid...SNAP-tag Control for nuclear localization 101123 pSNAPf-ADRβ2 Control Plasmid SNAP-tag Control for cell...pCLIPf-H2B Control Plasmid CLIP-tag Control for nuclear localization 101130 pCLIPf-Cox8A Control Plasmid ...CLIP-tag Control for mitochondrial localization 101125 pCLIPf-NK1R Control Plasmid CLIP-tag Control for cell...pMCP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization 101131 pACP-GPI Control Plasmid...-tag Control for cell surface localization 101128 pACP-ADRβ2 Control Plasmid ACP/MCP-tag Control for cell...mammalian expression 101133 pSNAP-CaaX Control Plasmid SNAP-tag Control for endomembrane (CaaX box) localization...

  9. Antibody Guide

    Type
    Collection
    ...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...

  10. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium sensor in astrocytes (GCaMP6f), cytosolic Conditions and constraints for astrocyte calcium signaling... inverse fluorescent biosensor for citrate (Citron/Citroff), mitochondrial or cytosolic High-Performance...proteins. Genetically encoded biosensors can be introduced into cells, tissues, or organisms for long-term... with different binding affinities or negative-control constructs used to characterize the sensor's behavior...differ from the original characterization (e.g. in vitro vs. in vivo , cytoplasmic vs. extracellular vs. ...295-300. Douglas Kim , GENIE Project Calcium Bicistronic vector expressing GCaMP6 and mRuby2 for imaging... GCaMP6f in PV cortical interneurons under the control of the E2 regulatory element Viral manipulation...

  11. Viral Production

    Type
    Collection
    ...Production Titer Quality Control Resources Lentivirus Production Titer Quality Control Resources Overview of...subunit (RPP30) as a control for normalization purposes are being used. Quality Control Mycoplasma The 293T...Addgene's viral production methods and quality control for lentivirus and AAV. Viral...virus preps are titered and subjected to quality control by Addgene before being distributed to customers...production protocols, titering methods, and quality control are described below. AAV Production AAV distributed...probes targeting the ITR elements and an internal control of known titer (protocol modified from Lock et ...performed by droplet digital PCR (ddPCR). Quality Control Addgene ensures high quality viral vectors by optimizing...

  12. Immunology Research Plasmids and Resources

    Type
    Collection
    ...murine) ecotropic retroviral transforming sequence C-CBL, CBL2, RNF55 CBLB Cas-Br-M (murine) ecotropic retroviral...TSHA CGB chorionic gonadotropin, beta polypeptide CGB3, hCGB CGB1 chorionic gonadotropin, beta polypeptide... 1 - CGB2 chorionic gonadotropin, beta polypeptide 2 - CGB5 chorionic gonadotropin, beta polypeptide 5...chorionic gonadotropin, beta polypeptide 7 CG-beta-a, FLJ35403, FLJ43118 CGB8 chorionic gonadotropin, beta... CKLFSF8-V2 CNTF ciliary neurotrophic factor HCNTF CNTFR ciliary neurotrophic factor receptor MGC1774 ...14, CST-17, CST-29 CRH corticotropin releasing hormone CRF CRHR1 corticotropin releasing hormone receptor...CSH2 chorionic somatomammotropin hormone 2 CS-2, CSB, hCS-B CSHL1 chorionic somatomammotropin hormone-like...

  13. Genetic Code Expansion

    Type
    Collection
    ...Badran 212125 pBK-Ma pylRS nitroY/haloY-F5 PylRS M. alvus 3-nitrotyrosine (3-nitro-Y), 3-halotyrosine (3-halo-Y...synthetases are introduced into the cell on plasmids and the new amino acid is introduced in the media. ...Mehl 85498 pDule-3-nitroTyrosine (5B) 3NY (5B) synthetase M. jannaschii 3-nitroTyrosine Bacterial TAG Ryan...Mehl 85499 pDule2-3-nitroTyrosine (5B) 3NY (5B) synthetase M. jannaschii 3-nitroTyrosine Bacterial TAG Ryan...Chin 174078 pDule-3-nitroTyrosine (A7) 3NY (A7) synthetase M. jannaschii 3-nitroTyrosine Bacterial TAG Ryan... 174079 pDule2-3-nitroTyrosine (A7) 3NY (A7) synthetase M. jannaschii 3-nitroTyrosine Bacterial TAG Ryan...cognate charged tRNA. Once these plasmids have been introduced in the cells, the non-canonical amino acid can...

  14. Luciferase Plasmid Collection

    Type
    Collection
    ...Biology CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that contains an intron in the middle ...in assays ranging from use as a reporter gene in vitro and in vivo to use in biosensors. The most common...expression constructs available that are driven by a strong constitutive promoter and can be used to monitor...created by fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Nano-lanterns , Enhanced...pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase gene fusions. Renilla luciferase under the control of a CMV promoter is present for normalization ...Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz 60323 pGL4.23...

  15. Lentivirus Plasmids

    Type
    Collection
    ...transfer plasmids Trono 12259 pMD2.G N/A Envelope VSV-G-expressing envelope plasmid Trono 8454 pCMV-VSV-G...1a-driven GFP and shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...transgene expression, contains intron that gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven... Transfer Plasmids Lentiviruses, a subset of retroviruses, are some of the most common and useful types...plasmids along with additional packaging components Trono 63586 psPAX2-D64V 2nd Packaging For making Integrase...transfer plasmids along with a plasmid encoding Rev Trono 12260 psPAX2 2nd Packaging Contains Gag, Pol, Rev...used with 2nd and 3rd generation transfer plasmids Trono 12263 pCMV delta R8.2 2nd Packaging Contains Gag...

  16. Biosensor AAV Preps

    Type
    Collection
    ...Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn Voltron-ST none Cre dependent 1 ...filtering options. *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the Karpova...proteins, including calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors...Oxytocin (OT) Sensors GRAB_OT Voltage Sensors Archon Voltron JEDI-2P ATP Sensors iATPSnFR2 5-HT Sensors GRAB... dependent) Serotype AAV1 AAV2 AAV5 AAV8 AAV9 Retrograde AAV PHPeB Clear Filters ID Name Promoter Sensor...pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Syn axon-GCaMP6s bicistronic mRuby3 Constitutive 5, 9 Tian 112010 pAAV-hSynapsin1... 140555 pAAV-hsyn-GRAB_DA-mut Syn GRAB_DA-mut (control) none Constitutive 9 Li 140556 pAAV-hsyn-GRAB_rDA1m...

  17. Lentiviral Prep Service

    Type
    Collection
    ...CRISPR Libraries Cas9 Pooled Barcoding Libraries Control Addgene's lentiviruses are made from plasmids that...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone does not contain SpCas9. 76,441...,114 human genes along with 1000 non-targeting controls Puromycin Doench , Root 73179 Human gRNA pooled...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone contains SpCas9. SpCas9 and 76,...,114 human genes along with 1000 non-targeting controls Puromycin Doench , Root Human activation pooled...57,050 unique sgRNAs along with 500 non-targeting controls. This backbone does not contain dCas9. 57,050 ...18,901 human genes along with 500 non-targeting controls Puromycin Doench , Root 92386 Human CRISPR inhibition...

  18. Bacterial Expression Systems

    Type
    Collection
    ...function under a wide range of highly controlled conditions in vitro , or, if you want to determine its ...Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids...Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may also like… ...produce large amounts of this protein and study it in vitro ? These, in addition to many questions about bacteria..., sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome...Manipulating the genome directly can give you more subtle control over protein expression and activity thereby limiting...Dammeyer Lactose/IPTG inducible vectors with LacIq, a stronger repressor than LacI that lowers basal protein ...

  19. Antibody Production

    Type
    Collection
    ... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...are initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...

  20. Tetracycline Inducible Expression

    Type
    Collection
    ... in search of inducible promoters capable of controlling eukaryotic gene expression. Several endogenous... regulator of gene expression, a tetracycline-controlled transactivator (tTA) was developed. tTA was created... transactivator rtTA ( r everse t etracycline-controlled t rans a ctivator) was created by fusing rTetR...and additional plasmids tetR-KRAB On Aebischer & Trono 16542 pBI-MCS-EGFP Expression of your gene of interest...Puro_Tet3G_3xFLAG_Twin_Strep Bidirectional promoter controls expression of gene of interest with Strep-Tag ...Blast (w756-1) Lentiviral reverse tetracycline-controlled transactivator 3 (rtTA3) expression vector, CMV... 3rd generation rtTA On Campeau 25434 pMA2640 Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin...

  21. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...81070 rAAV2-retro helper AAV retrograde AAV packaging plasmid, expressing Rep2 and retrograde capsid Alla...non-standard), expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Viviana Gradinaru...(non-standard), expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Viviana Gradinaru...non-standard), expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...plasmid (non-standard), expressing Rep2 and B10 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...plasmid (non-standard), expressing Rep2 and B22 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...non-standard), expressing Rep2 and MaCPNS1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...

  22. AAV Packaged on Request

    Type
    Collection
    ...facilitation, DNA amplification, and high-quality quality control measures such as titering, purity assessment, sterility...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy ...centrifugation purification Addgene’s comprehensive quality control process: Titering Purity assessment Sterility testing...produce the prep, and perform comprehensive quality control processes to make sure it is ready for your experiments...your AAV vector experience, from methods to troubleshooting insights, you make research more reproducible...gap between published methods and real-world troubleshooting. Eligible Plasmids The following plasmids are...including purification, titration, and quality control measures. We have distributed preps around the ...

  23. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...given donor-acceptor pair, the FRET efficiency strongly depends on the distance between the donor and ...linker-Cerulean-5aa linker-Venus-6aa linker-Venus V5V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 5 amino acid linker V17V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 17 amino acid linker V32V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 32 amino acid linker VVV Anisotropy/brightness standard consisting of three Venus... 5 and 6 amino acid linker, respectively VVVV Anisotropy/brightness standard consisting of four Venus ...5 and 6 amino acid linker, respectively VVVVV Anisotropy/brightness standard consisting of five Venus ...

  24. Viral Vectors

    Type
    Collection
    ...expression. γ-Retrovirus Plasmids | Guide γ-retroviruses, commonly referred to as retroviruses, are the most...integration. Community Resources Nolan Lab Retroviral Systems Trono Lab Lentivector Toolbox Guide to Generating...Adenoviruses are commonly used as vaccines because of the strong immunogenic response they induce. Some (oncolytic...this infectivity is limited to dividing cells. Retroviruses integrate permanently into the host genome, ...virus (as happens in nature), researchers can introduce plasmids to a host to generate virus. Furthermore...DNA >8 Kb 105 Dividing/Non-dividing No High γ-Retrovirus Stable RNA <8 Kb 80-130 Dividing Yes Moderate...

  25. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Image from Fenno et al., 2014. INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting...and Flp) recognition sequences within synthetic introns. INTRSECT was first shown as a proof-of-concept...transgenic recombinase-expressing animal lines and retro-grade expressing viruses delivering additional recombinases.... Figure 2: INTRSECT works by inserting short, intronic sequences into the open reading frame (ORF) of...sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The addition of these recombinase recognition...recognition sequences enables directional control of the portion of the ORF that is sandwiched between the... combinations of recombinases are present, the introns are excised during mRNA processing, producing a...

  26. CRISPR Guide

    Type
    Collection
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...

  27. CRISPR Plasmids - Drosophila

    Type
    Collection
    ... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...49410 pCFD3-dU6:3gRNA dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...

  28. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14666 pQE9-His-p97...T7 Parkinson's Dmytro Yushchenko 107293 s2. pT7-7-SNCA-5Asp SNCA T7 Parkinson's Dmytro Yushchenko 107294... T7 Parkinson's Dmytro Yushchenko 107295 r. pT7-7-SNCA-5Asn SNCA T7 Parkinson's Dmytro Yushchenko 107296...T7 Parkinson's Dmytro Yushchenko 107297 r-22. pT7-7-SNCA-9Asn SNCA T7 Parkinson's Dmytro Yushchenko 107425...neuroaxonal dystrophy Michael Ward 178167 RNF216_Halo_C_allele RNF216 Halo Hypogonadotropic hypogonadism...Ataxia Pietro De Camilli 194005 VPS13D1-1576-(Y1253S) VPS13D GFP CMV Spinocerebellar Ataxia Pietro De Camilli...research related to Alzheimer's Disease (AD), Amyotrophic Lateral Sclerosis (ALS), Frontotemporal dementia...

  29. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...test the function of your gene of interest in a controlled environment under various conditions. When choosing...tag for mammalian expression (Gateway) pYIC - Bicistronic fluorescent reporter gene with cap-dependent ...expression, see our dedicated Lentiviral Plasmids page Retroviral Easy and safe to use, integrate into host genome...MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable... production AAV-GfaABC1D-MCS--4x6T-WPRE - For astrocyte-selective expression in AAV Dual promoter Separate...transient expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP...

  30. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... 10 6 cells in 100 μl of electroporation solution and add to electroporation cuvette. Add 5 μg of each...construct. Electroporate cells with 250 volts for 5 msec in a 2 mm cuvette using an electroporation system...of culture media after electroporation. Minimize the time between electroporation and transferring the ...manuscript here: Bauer et al, 2014 322.2 KB If you have trouble loading this video, please try viewing on YouTube...involves the delivery of CRISPR/Cas9 plasmids by electroporation 4 . This protocol is described in detail for...Li D, Li J. Cell Stem Cell . 2013. PubMed . Electroporation: theory and methods, perspectives for drug ...

  31. Serotype Testing AAV

    Type
    Collection
    ...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype ...fluorescent reporters and can be used to compare the tropism of different serotypes. In addition to the standard...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized... catalog item, including the titer and quality control, visit the material page (linked for each catalog...AAV9 37825-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP...AAV9 50465-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 50465-AAVrg.T 20 µL $ 140 Add to Cart *Each viral...

  32. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

  33. AAV Viral Preps

    Type
    Collection
    ... of control AAV vectors for trial purposes in serotypes AAV1, 2, 5, 8, 9 and retrograde Retrograde AAV...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy .... Addgene’s comprehensive high-quality quality control process includes titering, purity assessment, sterility... Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster, Brainbow...

  34. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...gRNAs with the Cas9 nickase which will together introduce cleavage of the target site with efficiency similar...on each side flanking the change you'd like to introduce. We use Ultramer oligo from IDT (non-PAGE purified...although this might still be okay if you are introducing a selection marker gene. The homology arms should...ideally less than 10bp away if possible. For introducing small mutations (<50bp) or a single-point mutation...around 100-150bp total homology. The mutation is introduced in the middle, giving 50-75bp homology arms. ...double digestion. As a successful insertion will destroy the BbsI sites, a double digest should discriminate...BbsI and AgeI will be able to cut). After the introduction of a mutation into the genome, how can cells...

  35. Plan Your Experiment

    Type
    Collection
    ...viral delivery RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA... to target cells through microinjection or electroporation Transient expression of CRISPR components Expression...ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA...repaired DSBs): For small nucleotide edits that introduce a novel restriction site. The region of interest...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA delivery into the...enables efficient protein-based genome editing in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80...

  36. AAVED

    Type
    Collection
    ...targeted neuronal manipulation (aka intersectional control). The end result of the meeting will be a publicly... AM Cre and Flpo Katherine Matho 10:15 AM AAV Retrograde Tracing Gowan Tervo and Sarada Viswanathan 11...tips for using the technology in the lab (e.g., controls to perform, recommended histology conditions, ... examples of AAV strategies for intersectional control. Please see our list of suggested materials below...of research materials to share: In vivo data: Retrograde hSyn1-GCaMP6f-P2A-nls-dTomato Detailed protocol...reference for AAV use in neuronal intersectional control. Through your participation in this meeting, you...

  37. Zebrafish Plasmid Collection

    Type
    Collection
    ...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...horizontal stripes on the sides of the adult body, is a tropical freshwater fish in the minnow family. It has long...refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology or the zebrafish CRISPR...ALS-linked aggregates in real time. Live imaging of astroctyes - Kelly Monk Lab. Live imaging tools to study...study the development and function of zebrafish astrocytes. Knock-in tagging - Michel Bagnat lab. Targeting...

  38. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...intracerebroventricular (ICV) delivery in newborns, and retro-orbital (RO) and stereotaxic (STX) delivery in adult...minBG-SYFP2-WPRE3-BGHpA AiP14470 AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531...minBG-SYFP2-WPRE3-BGHpA AiP12558 AiE0390m_3xC2 SYFP2 Astrocytes Whole Brain 208163 pAAV-AiE0390m_3xC2-minBG-iCre...-iCre(R297T)-BGHpA AiP14801 AiE0390m_3xC2 Cre Astrocytes Whole Brain 208143 pAAV-AiE0390h_3xC2-minBG-SYFP2...minBG-SYFP2-WPRE3-BGHpA AiP13572 AiE0390h_3xC2 SYFP2 Astrocytes Whole Brain 208133 pAAV-AiE0387m-minBglobin-SYFP2...-SYFP2-WPRE3-BGHpA AiP12102 AiE0387m SYFP2 Astrocytes Whole Brain 208166 pAAV-AiE0387m-minBG-iCre(R297T...R297T)-BGHpA AiP13999 AiE0387m Cre Astrocytes Whole Brain 220643 pAAV-AiE2128m-minBG-SYFP2-WPRE3-BGHpA AiP1357...

  39. TALEN Plasmids and Kits

    Type
    Collection
    ...expression is driven by the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7...promoter. RCIscript-GoldyTALEN is designed for in vitro synthesis of TALEN mRNAs. Both 5’ and 3’ Xenopus...of the DNA-binding domain of a TALE, along with strong nuclear localisation tags and repress transcription... T7 promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which ... included for generating TALEN mRNAs through in vitro transcription as an alternative. Based on transient...

  40. Neurodegeneration Research Collection

    Type
    Collection
    ...collections available at Addgene. Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS), sometimes...being adopted in the field. Read on for a brief introduction to the genetics associated with some of the ...Symptoms include changes in behavior and emotion, uncontrolled movements, memory deficits, as well as difficulty...neurons in the substantia nigra, one of the movement control centers in the brain. The cause of this neuron ...Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human...

  41. Optogenetics Plasmid Collection

    Type
    Collection
    ...Optogenetics plasmids encode proteins that are controlled by light. Many of these plasmids encode for microbial...the cell. When using these opsins as a tool to control neuronal activity, scientists generally attach ...localization. Many other types of proteins can also be controlled by light, generally by utilizing a light sensitive...fusions can then be used as an optical switch to control protein interactions, dimerization, localization...the table below for plasmids that use light to control a protein or cellular activity. For example, search...

  42. CRISPR Plasmids - C. elegans

    Type
    Collection
    ... In vitro transcription none, need Cas9 plasmid Boxem 47912 SP6-sgRNA-scaffold SP6 AflII In vitro transcription... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...R07E5.16 U6 yes, cut Goldstein 42250 DR274 T7 BsaI In vitro transcription none, need Cas9 plasmid Joung 46170...

  43. AAV for Neuronal Tracing

    Type
    Collection
    ...viral service encoding tools for monosynpatic retrograde neuronal tracing, to be used with modified rabies...be used with modified rabies virus to perform retrograde neuronal tracing. Note : Addgene does not distribute... pAAV-TREtight-mTagBFP2-B19G AAV1 Wickersham Introduction to Rabies Virus-based Monosynaptic Tracing The...-deleted rabies to specific starter cells, the tropism of this virus was modified so that it could only..., Finke S, Conzelmann KK, Callaway EM. 2007a. Retrograde neuronal tracing with a deletion-mutant rabies...

  44. CRISPR References and Information

    Type
    Collection
    ...wide range of organims. Developed by the Michael Boutros Lab . CasFinder: Flexible algorithm for identifying...107 KB Chen and Wente Zebrafish: gRNA cloning, in vitro transcription, injection gRNA core ; Cas9 ; optimized...Fujii gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP)... packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library...lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for...

  45. Optogenetics AAV Preps

    Type
    Collection
    ... Optogenetics AAV *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the Karpova...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Optogenetics is typically used in neuroscience to control electrical potentials in neurons. See our Optogenetics...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? ...

  46. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mammalian/in vitro transcription BsaI none S. pyogenes Mark pU6T7 71462 Mammalian/in vitro transcription...pyogenes Luikart pRubiG-T2A-Cas9 75348 Mammalian/Retroviral from pXL yes, activate S. pyogenes EGFP Luikart...Luikart pRubiC-T2A-Cas9 75347 Mammalian/Retroviral from pXL yes, activate S. pyogenes mCherry Luikart pDECKO_mCherry...Gateway recombination-based cloning of complex polycistronic lentiviruses. Can express Cas9 with up to 3 ...in a single vector. sgRNAs are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG ...

  47. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...Cut Fully functional Cas9 enzymes designed to introduce a double-strand break (DSBs) at a specific location...high homology to the DNA surrounding the DSB is introduced along with the Cas9 and gRNA plasmids, the cell...error-prone than NHEJ and can be used to faithfully introduce specific genomic changes. ID Plasmid Gene/Insert...NGG) 51306 pUC57-Simple-gRNA backbone T7 BsaI In vitro transcription none, need Cas9 plasmid Chen Do you...

  48. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...BsmBI In vitro transcription none, need Cas9 plasmid Chen and Wente 42250 DR274 T7 BsaI In vitro transcription... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...

  49. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... store a record of invading phages but also to destroy the phages upon re-exposure. More specifically,...complex binds to the foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview...could be programmed for targeted DNA cleavage in vitro. In 2013, Cong et al. and Mali et al. described ...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s ...Weissman JS. 2014. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell . 159(3...

  50. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...HIV-based lentiviral particles Murine leukemia-based retroviral particles Vesicular stomatitis virus particles...Description Mutations Industry PI Due to export control regulations, MERS and SARS-CoV materials are available...Lentiviral Envelope and Packaging Plasmids Popular γ-Retrovirus Envelope and Packaging Plasmids Reporter Plasmids...vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing firefly luciferase...
Showing: 51 - 100 of 916 results