We narrowed to 728 results for: STO
-
TypeCollection...brain tissue. PRISM begins with the delivery of stochastic combinations of cell-filling antigenically distinct...individual synapses. Figure 2: PRISM workflow. A) Stochastic infection of pooled AAVs delivered in vivo generates...
-
Chemogenetics AAV Preps
TypeCollection...Gi) hM4D(Gi) - Inhibition HA fusion none 2, 5 Christopher Richie 121539 pAAV SYN1 HA-hM3D(Gq) hM3D(Gq) ...) - Activation HA fusion none 2, 5, rg* Christopher Richie 50467 pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine... -
Worm Expression Resources
TypeCollection... described in Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis... - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold Spring ... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...109121 HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP ... -
AAV Packaged on Request
TypeCollection... biosafety protection levels. We offer 1,046 in-stock viral vector preps, delivering high quality and ...scientists sometimes require preps beyond our current in-stock capabilities. To meet that need, our Packaged on... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...originally discovered as contaminants of adenovirus stocks. One major advantage of using AAV for research ... and learn about our options for hundreds of in-stock preps that are ready to ship right away, as well... -
CRISPR Plasmids - Mammalian Expression
TypeCollection... Available modifications include histone acetylation by p300, histone demethylation by LSD1, cytosine ... -
Ras Pathway
TypeCollection...oncogene homolog Muscle RAS oncogene homolog Neuroblastoma RAS viral (v-ras) oncogene homolog RASA RASA1...RASSF10 Ras association domain family member RB1 Retinoblastoma 1 RCE1 Ras converting CAAX endopeptidase 1 ... -
CRISPR Guide
TypeCollection...insertions, or frameshift mutations leading to premature stop codons within the open reading frame (ORF) of the... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers... green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence microscopy...gene by shifting the ORF and/or creating premature stop codons NHEJ N on- H omologous E nd J oining; A DNA... -
Validated gRNA Sequences
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Empty gRNA expression vectors for insertion of custom gRNA target sequences...._LacZ 74293 Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes,... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Constitutive or Cre-dependent) Cell-specific restoration of stimulus preference after monocular deprivation...cpFRET kit from the Pertz laboratory to construct custom biosensors. The ScEnSor Kit from the Olsson laboratory... -
CRISPR Plasmids - Epigenetics
TypeCollection...for targeted epigenetic modification, including histone acetylation/demethylation, and cytosine methylation... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...like GFP, researchers have turned dCas9 into a customizable DNA labeler compatible with fluorescence microscopy... -
DNA Service - Cloning Grade DNA
TypeCollection...resources you may find helpful. Our Scientific and Customer Support Teams are also available to provide assistance... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...possible to study the effect of the amount and stoichiometry of enzymes. The pLC97 plasmid allows for quick... -
CRISPR Plasmids and Resources
TypeCollection...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial... -
CRISPR Plasmids - C. elegans
TypeCollection...Ingestion by C. elegans none, need Cas9 plasmid Ristow Do you have suggestions for other plasmids that... -
Synthetic Biology - Overview
TypeCollection...Lei Stanley Qi Jeff Tabor Jan-Willem Veening Christopher Voigt Clifford Wang Ron Weiss Synthetic biology... -
Recombinases AAV Preps
TypeCollection...Recombinases VCre AAV Browse the following tables for in-stock AAV preps that encode site-specific recombinases... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...Scar: ACCGGC Features: Modified RFC 10 w/ start and stop codons; Creates in-frame fusions w/ linker Thr-Gly... -
Viral Vector Guides and Plasmids
TypeCollection... collection. Addgene also has a selection of in-stock viral preps available. Browse Guides and Plasmids... -
Distribution to Industry
TypeCollection...SUMO Protease Elution Protein Characterization Christopher Bahl A validation set of 96 unique, single-domain... -
Promega Plasmid Collection
TypeCollection...visualization, and functional studies. You can even customize ligands for your specific purpose. HaloTag technology... -
Plant Plasmids and Resources
TypeCollection...reproduces, and distributes diverse seed and other stocks of Arabidopsis thaliana and related species. The... -
Lentiviral Prep Service
TypeCollection...Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR Libraries Cas9 Pooled Barcoding... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection... novel AAV vector targets ON bipolar cells and restores visual function in a mouse model of complete congenital... -
COVID-19 Resources
TypeCollection...Cytokines - SARS-CoV-2 infection induces a cytokine storm response in the body. For a full list of cytokines... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...domain and the phosphosite, mCherry fluorescence is restored, so interactions can be discovered by fluorescence-activated... -
CRISPR References and Information
TypeCollection...Tool (Link opens in a new window) Design gRNAs for custom CRISPR screens targeting a long or short list of...