Skip to main content
Addgene
Showing: 101 - 150 of 721 results
  1. Plan Your Experiment

    Type
    Collection
    ...Reports . 5 , 11315. PMID: 26066060 Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. ...
  2. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Anti-Copper ATPase 2 (Wilson's disease protein) [L62/29] Copper ATPase 2 (Wilson's disease protein) Human...
  3. CRISPR Guide

    Type
    Guide
    ... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer, E. J. (2019)...S., Cofsky, J. C., Kranzusch, P. J., Sontheimer, E. J., Davidson, A. R., Maxwell, K. L., & Doudna, J. ..., J., Edraki, A., Shah, M., Sontheimer, E. J., Maxwell, K. L., & Davidson, A. R. (2016). Naturally occurring... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti...
  4. Cloning

    Type
    Guide
    ...back by the 5' exonuclease. Gibson Assembly (Image from Plasmid 101: Gibson Assembly ) Back to Top Type...Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning Oligo Stitching...cost, availability of starting materials or just personal preference. Check out our blog on choosing the... is the "classic" cloning method, and for many reasons, remains one of the most popular today. Restriction...Plasmid 101 blog post on TOPO cloning. Back to Top Gibson Assembly (Isothermal Assembly Reaction) Isothermal...Isothermal cloning, more commonly known as Gibson assembly ( protocol ), takes advantage of the properties ...lastly DNA ligase fuses DNA strands together. In Gibson assembly DNA fragments with 20-40 base pair homology...
  5. Optogenetics Guide

    Type
    Guide
    ...t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos...helveticum 500 Chrimson, ChrimsonR Red-light drivable channel from Chlamydomonas noctigama . ChrimsonR carries...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...Ramakrishnan C, Mattis J, Prakash R, Diester I, Goshen I, Thompson KR, Deisseroth K. 2010 Molecular and cellular ...Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ...Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson CA, Sabatini BL 2012. Novel recombinant adeno-associated...21363959 Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein...
  6. Antibody Guide

    Type
    Guide
    ...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...may need additional processing steps, such as sonication. Denature proteins, using heat and/or chemicals...housekeeping genes). This allows for relative comparison of expression between different samples, by normalizing...normalizing protein expression to the controls before comparison. Alternatively, the samples can be normalized...ChIP protocols use enzyme digestion instead of sonication. This approach is gentler but results in non-...isolated and analyzed. Validation relies on size comparison of peptides. Independent antibody validation ...
  7. Chemogenetics Guide

    Type
    Guide
    ...19607790 (Link opens in a new window) Atasoy D, Sternson SM (2018). Chemogenetic Tools for Causal Cellular...Magnus CJ, Lee PH, Atasoy D, Su HH, Looger LL, and Sternson SM (2011). Chemical and genetic engineering of...Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent chemogenetics for research...6. PMID: 11402033 (Link opens in a new window) Sternson SM, Roth BL (2014). Chemogenetic tools to interrogate...26399324 (Link opens in a new window) Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al. (2015)... Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, Kotsonis TA, Yuan T, You Z, Wu Z, Xi J, Haberman A, Graham...
  8. Sequencing Primers

    Type
    Guide
    ...Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) ...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...
  9. Lentiviral Guide

    Type
    Guide
    ...plasmids are based on the HIV-1 virus. For safety reasons, transfer plasmids are all replication incompetent...generation or 3rd generation packaging system. For a comparison of the key differences between the 2nd and 3rd...
  10. Plan Your Experiment

    Type
    Guide
    ...Reports . 5 , 11315. PMID: 26066060 Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. ...
  11. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ...Transposagen What is the piggyBac™ transposon? The piggyBac™ transposon was originally identified in moths...until 2005 [1]. Like other transposons, piggyBac™ has two components, a transposon and a transposase. The ...titrating the transposase to transposon ratios. High ratios of transposase to transposon result in a greater number...ability to distribute plasmids with the piggyBac™ transposon. These plasmids, when combined with a source ...you to quickly transfer a DNA sequence from the transposon vector to one of many TTAA sequences distributed...genome. We encourage you to deposit your piggyBac™ transposon vectors with us to help us expand this useful...transposase facilitates the integration of the transposon specifically at ‘TTAA’ sites randomly dispersed...
  12. Sleeping Beauty Awakens for Genome Engineering

    Type
    Blog Post
    ...important for social and regulatory reasons. 1.) The transposon consists of a mirrored set of inverted....   The Sleeping Beauty transposon system The Sleeping Beauty (SB) transposon system is one such system...Transposons are sequences of DNA that can move around in a genome. In a laboratory setting, transposons...the site of insertion. In both of these cases, transposons combine the advantages of viruses and naked DNA...mechanisms. The use of non-viral vectors, like transposons, avoids many, though not all, of these defenses...reaction occurs which cuts the DNA.3.) The released transposon can now bind a strand of DNA with a TA dinucleotide...plasmid is empty following the removal of the transposon; the plasmid is then degraded by the cell.4.)...
  13. 7 Simple Strategies to Resolve Conflicts with Difficult Supervisors

    Type
    Blog Post
    ...but he or she probably has reasons for it. Do not take criticism personally or get defensive. Look at ...important issues in person or over the telephone instead of email. As you cannot see a person’s body language...get nods from nearly every participant. Robert Bramson, author “Coping with Difficult People,” identified...specific strategies to deal with each of these personality types is beyond the scope of this article, there...resolve conflicts What Is Assertiveness? An assertive person is able to communicate their ideas confidently ...your supervisor, even if he or she is a difficult person: 1) Understand your supervisor’s expectations ...or she would like a written report or to meet in person.   Regardless of your supervisor’s management style...
  14. Transferable Skills Guide: Teamwork

    Type
    Blog Post
    ...were usually the products of teams: Watson, Crick, & Franklin, Meselson-Stahl, Hershey-Chase...Who was I ...intelligent, motivated person really could know a little bit about everything or in Jefferson’s case, even a lot...work of more than one person. A selfish part of you might not want another person’s name on your next paper...clear why that person is there. If it becomes clear after a few meetings that a person is neither adding...all our externally facing kit pages. No single person could possibly understand every nuance of how kits...should have a goal, or at the very least, a clear reason for existing. Here are a few types of teams that... - with the possible exception of when Thomas Jefferson dined alone.” There was a time in human history...
  15. Transferable Skills Guide: Conflict Resolution

    Type
    Blog Post
    ...to the conclusion that a conflict is personal (”Person A and Person B just don’t get along”) when in fact...conflict are substantive (“Person C told Person A one thing and inadvertently told Person B something else.")...also be categorized as either “personal” or “substantive”. A personality-based conflict occurs when two...multiple channels is not reasonable or sustainable. That said, when you know that a person or team should be ...large organization, because confirming that every person has read and understood every communication that...assign the responsibility in question to a specific person or team. What Makes You a Good Conflict Resolver... for a fight. But you also can’t be the type of person who avoids conflict at all costs or actively runs...
  16. 7 Tips to Secure a STEAM Internship This Summer

    Type
    Blog Post
    ... result of the necessary restrictions on close personal contacts. However, that should not deter any student... letter can be found on the Addgene blog.   3. Personal statement brilliance In addition to sending in... cover letter, you are always asked to draft a personal statement, which is the perfect opportunity to...questions, thus devoting some time to writing a solid personal statement will pay dividends. This is the only...and forward-looking. Embrace it, and let your personality leap out of the page. Finally, as previously ...find the tools that can help you craft a solid personal statement.  4. Letters of recommendation wisdom...to vouch for the character you painted in your personal statement. Make certain to choose your recommenders...
  17. Molecular Biology Reference

    Type
    Guide
    ...essential tool in molecular biology for a variety of reasons, including that they are: Easy to work with - Plasmids...
  18. Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System

    Type
    Blog Post
    ... year’s Michael Davidson and Roger Tsien Commemorative Travel Awards: Melissa Chiasson, Elizabeth Unger...variation at large scales and making personalized medicine a reality,” Chiasson explains. Elizabeth Unger: Developing...The late Michael Davidson and Roger Tsien played enormous roles in fluorescent protein development by...To honor their legacy, we launched the Michael Davidson and Roger Tsien Commemorative Travel Awards in...Unger, and Michal Bernach. Melissa Chiasson: Quantifying the abundance of thousands of protein variants ...time is time consuming and unscalable.  Melissa Chiasson, a graduate student in Douglas Fowler's lab at...from each bin are then extracted and sequenced. Chiasson is currently using VAMP-seq to study vitamin K...
  19. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,.... coli Ec48 retron RT and the S. pombe Tf1 retrotransposon RT, respectively. Their small size comes at... even in contexts where expression was reduced (Nelson et al., 2022). PE7: An alternate approach to RNA...RNA stability This recent contribution by the Adamson lab also addresses the problem of RNA stability....References Anzalone, A. V., Gao, X. D., Podracky, C. J., Nelson, A. T., Koblan, L. W., Raguram, A., Levy, J. M....A. A., Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C., Newby, G. A., Raguram, A., & Liu, D. R. (2019...
  20. Design Tips for Prime Editing

    Type
    Blog Post
    ... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,...-RNA base pairing with the primer binding site (Nelson et al., 2022). PE7: This editor includes the fused...A. A., Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C., Newby, G. A., Raguram, A., & Liu, D. R. (2019...e29. https://doi.org/10.1016/j.cell.2021.09.018 Nelson, J. W., Randolph, P. B., Shen, S. P., Everette,...Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson, D., Zhao, A., Li, H., Yan, W., Goudy, L., Schmidt...
  21. Live and Let Dye: Self-Labeling Protein Tags

    Type
    Blog Post
    ..., based on resorufin). SNAP-tag: In 2003, Kai Johnsson’s lab developed a self-labeling fusion tag based...Addgene’s collection. CLIP-tag: Also in 2008, Kai Johnsson’s lab reported another AGT-based tag named CLIP-tag...STED) nanoscopy. Scale bar, 2 μm. Inset shows comparison with standard confocal microscopy. Image adapted...159 aa) are smaller than HaloTag (295 aa) – for comparison, common fluorescent proteins are typically 230...Wissner, R. F., Xi, Z., Allgeyer, E. S., Zhong, S., Thompson, A. D., Lowe, N., Butler, R., Bewersdorf, J., ...Strategies Matter for Super-Resolution Microscopy: A Comparison between HaloTags and SNAP-tags. Cell Chemical...Corrêa, I. R., Kindermann, M., Beaufils, F., & Johnsson, K. (2008). An Engineered Protein Tag for Multiprotein...
  22. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...new variant was named ChrimsonR. Plasmids containing Chronos, Chrimson, ChrimsonR, CsChR, and CoChR have...inactivation. Find the Robinson plasmids or the Royle plasmids and get to work! Robinson et al., Dev Cell...Updated mini-transposon vector for bacterial mutagenesis or gene targeting Victor de Lorenzo's lab...selecting the important elements from existing transposon and vector systems and creating an all-synthetic...British idiom for “taking by surprise”) by Margaret Robinson’s lab, and more recently used by Stephen Royle’...Shining a light on channelrhodopsins – Chronos & Chrimson Through de novo sequencing of 127 algal transcriptomes...include a pair of channelrhodopsins, Chronos and Chrimson, which have enabled the group to perform independent...
  23. Transferable Skills: Negotiation

    Type
    Blog Post
    ...everyone wins. What are the underlying reasons for this person’s request? Your colleague is if someone...need help from another person/team at the company. How do I negotiate with the person/team for help? What...can help you understand the perspective of all persons involved and be used as a guide to point you toward...important plans? What is most important to each person? Someone has to be the first author but another...agrees to pick up both children while the other person uses an available after-hours time slot.  You were...thoughtful about what is most important to each person. It can especially be difficult to think creatively...supervisors and lead to you being remembered as a person who tries to find solutions that benefit everyone...
  24. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ...modify a given gene. CRISPR-tranposons By combining CRISPR editing and transposons, the Sternberg and Zhang...pneumoniae. Robert Husson lab's M. tuberculosis CRISPRi plasmids A group from the Husson lab used CRISPRi...insert extra elements, like a repair template, using Gibson Assembly or restriction enzyme cloning. Streptomyces...Zhang labs developed CRISPR-transposons. The Sternberg lab's system called INTEGRATE (Insertion of Transposable...By using a multi-spacer CRISPR array, CRISPR-transposons can be multiplexed. Transcriptional repression...CRISPRi for Gram-negative and Gram-positive bacteria Jason Peters, Oren Rosenberg, and Carol Gross used two...https://doi.org/10.1038/s41564-018-0327-z Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP...
  25. MXS Chaining

    Type
    Blog Post
    ...compatible cohesive ends Engler et al., 2008 Gibson Cloning Gibson assembly method Single reaction, can assemble...Central PMCID: PMC2574415. 3. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO.Enzymatic assembly...terminus or the 3’ terminus of the ligation product. Comparison to other high throughput cloning strategies There... identical polyadenylation signals or promoters Gibson et al., 2009 MXS-Chaining, BioBricks, Bglbricks...Sladitschek and Neveu, 2015; Shetty et al., 2008; Anderson et al., 2010 Among the chaining-based methods...Additional Resources on the Addgene Blog Read about Gibson Assembly Learn About Other Plasmid Cloning Techniques... Find Plasmid Cloning Protocols References 1. Anderson JC, Dueber JE, Leguia M, Wu GC, Goler JA, Arkin...
  26. Antibodies 101: Fc Effector Functions

    Type
    Blog Post
    ...process known as opsonization. In antibody-dependent complement deposition (ADCD), opsonization of IgG and ...isotype class or even subclass, and are part of the reason why different isotypes drive different types of... in the pathogen’s cell membrane (Dunkelberger & Song, 2010). As cells cannot survive when holes are punched...(ADCC) is a slightly more direct method than opsonization. In ADCC, IgG antibodies bind to a pathogen ..., our antibodies have induced “stabbing” and “poisoning,” but let’s be honest, the elimination style the...10.1038/74704. PMID: 10742152. Dunkelberger, J., Song, WC. Complement and its role in innate and adaptive...  Rachel Leeson...
  27. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ... you want to make will happen.  There are many reasons to multiplex gRNAs, some being: Using dual nickases...the Bullock lab, and gRNAs can be inserted using Gibson Assembly or SLIC cloning methods. A BsaI-based ... up your multiplexed gRNAs with Golden Gate and Gibson assembly methods If you want to scale up the number...use some assembly methods such as Golden Gate or Gibson assembly. Golden Gate Assembly of gRNAs Golden ...supply it with another plasmid.   Figure 3: Comparison of Multiplex Strategies including Standard PolIII-gRNA...Multiplexing in plants Qi-Jun Chen Lab Golden Gate/Gibson Assembly Multiplexing Plasmids: These plasmids ...you to assemble 2-4 gRNAs through Golden Gate or Gibson Assembly. gRNAs are inserted into the pCBC vectors...
  28. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...making the detection of rare events difficult. Dickinson et al. sought to create a new and efficient selection-based...Figure 1: Self-excising cassette schematic from Dickinson et al. (2015). Used with permission from the Genetics...your gene of interest into the FP-SEC vector using Gibson assembly. This construct will serve as the repair...for the targeted gene. After initial testing, Dickinson et al. tested this system across 7 genes in parallel...modification. Figure 2: Schematic from Dickinson et al. (2015) illustrating the steps to fluorescently...Society of America. Applications of this system Dickinson et al. have developed a modular system that requires...with a Self-Excising Drug Selection Cassette. Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein...
  29. Antibodies 101: ChIP

    Type
    Blog Post
    ...background information. Your options for this step are sonication, which uses high-frequency sound waves to break...break up the DNA, or enzymatic digestion. Sonication provides a truly random digestion, but is harsher ...to the selective nature of the cutting. While sonication is usually the preferred method, enzymatic digestion...concentration.  Protein Capture After crosslinking and sonication or enzymatic digestion, you’re ready to incubate...availability, which could affect antibody selection. Sonication (or enzymatic digest) will also have to be optimized...fragment length for your output assay. A longer sonication time could mean needing to increase crosslinking...effects of increased sample agitation; a shorter sonication time could be an opportunity to decrease crosslinking...
  30. When Fidelity Matters: A frank discussion about ligase fidelity

    Type
    Blog Post
    ...PubMed Central PMCID: PMC146043. 9. Nilsson, Stefan V., and Göran Magnusson. "Sealing of gaps in duplex DNA...gaps. For example, DNA assembly methods, such as Gibson Assembly® and NEBuilder® HiFi DNA Assembly, require...for a ligase? DNA ligases generally prefer fully Watson-Crick base-paired dsDNA substrates to those containing... base-pair size nearly indistinguishable from a Watson-Crick base pair, are joined with nearly the same...phosphate to the ligation). The structural/mechanistic reason for this differential is not known for certain,...allowed screening of all possible base combinations (Watson-Crick and mismatched) around the ligation junction....6 (2004): 757-764. PubMed PMID: 15582400. 2. Tomkinson, Alan E., et al. "DNA ligases: structure, reaction...
  31. Transferable Skills Guide: Managing a Team

    Type
    Blog Post
    ...I first became a manager. Know your people Each person is unique and should be managed accordingly.  I...role is not to do all the work yourself anymore. Personally I found this to be particularly challenging. ...important” tasks my schedule. This was bad for 2 reasons. First, it soon became obvious that I didn’t have...accordingly -  but think of it as an investment: once the person is trained you will have more time to focus on ...identify what to delegate and to whom (make sure that person has time for it!). Then schedule a meeting to discuss...Unless you’re delegating a recurring task to a seasoned report, there should be questions! Remember that...learned to embrace them after one ended with the person in front of me saying “I’ve been doing some of ...
  32. Beyond the Blood Brain Barrier: PHP.B Enters the Central Nervous System Via the LY6A Receptor

    Type
    Blog Post
    ...the Deverman lab at the Broad Institute and the Wilson lab at the University of Pennsylvania independently...unlikely receptor for PHP.B, and how the Deverman and Wilson labs determined LY6A was a receptor used by PHP.B... PHP.B CNS permissiveness Both the Deverman and Wilson labs determined LY6A, also known as stem cell antigen... role in viral susceptibility. The Deverman and Wilson Labs independently identified LY6A as a receptor...was a likely player in PHP.B permissiveness. The Wilson Lab also looked for the gene variant responsible...require galactose and AAVR to transduce cells. The Wilson Lab generated results similar to the Deverman Lab...’s transduction of 293T cells. In addition, the Wilson Lab also tested the ability of PHP.B to transduce...
  33. Fostering communication in remote collaborations

    Type
    Blog Post
    ... of your lab that you see in person, and helps improve your interpersonal relationships with people you...emailing documents to one person at a time. Just be sure there is a point person responsible for incorporating...replicates how you’d interact with team members in person, and improves overall communication.  Maintain...out if any milestones are missed. Spend time in person Presenting the results from my lab exchange...having collaborators spend time with each other in person. One possibility is to do a lab exchange, where...
  34. Pushing the Limits of DNA Assembly

    Type
    Blog Post
    ...to our guest blogger Lydia Morrison from New England Biolabs. Lydia Morrison is a biochemist by training...This post was contributed by guest blogger Lydia Morrison from New England Biolabs. What is DNA assembly...multiple methods of DNA assembly available, including: Gibson Assembly®, BioBrick® Assembly, Golden Gate Assembly...Assembly, and NEBuilder® HiFi DNA Assembly. Gibson Assembly allows the production of scarless DNA constructs...opens the door for new opportunities in the field.  Gibson Assembly® is a registered trademark of Synthetic... Addgene Blog Learn More about Gateway Cloning Gibson Assembly and Other Long-Homology Based Cloning ...
  35. Optimizing Donor DNA for Enhanced CRISPR Genome Editing

    Type
    Blog Post
    ...This post was contributed by guest blogger Chris Richardson, a Postdoctoral Researcher in Jacob Corn’s lab...and yet unanswered) question. Our recent paper (Richardson et al 2016) revealed some of the biophysical ...binding to the cleaved DNA duplex. Image from Richardson et al., 2016. We next wondered if we could...interaction with the Cas9-DNA duplex. Image from Richardson et al., 2016.   dCas9 enables sequence replacement...Results from our lab and others (Lin et al 2014, Richardson et al 2016, and Kim et al 2014) have shown that...transcribed sgRNA, and optional donor DNA. Chris Richardson is a Postdoctoral Researcher in Jacob Corn’s ...worked on this publication:         References 1. Richardson, Christopher D., et al. "Enhancing homology-directed...
  36. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...called GMAP (Gibson assembly-based modular assembly platform). GMAP is based on the Gibson Assembly method...Parton DL, Hanson SM, Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM, Chodera...as individual plasmids shipped as agar stabs. Iverson, et al. ACS Synth Bio. 2015. PubMed PMID: 26479688...30-40bp overlaps). To expand the capabilities of Gibson assembly and make a more modular platform, the ...context-dependent human fitness genes, the laboratory of Jason Moffat at the University of Toronto has created ...Vectors Available at Addgene: Lab Plasmids Dan Carlson RCIscript-GoldyTALEN, pC-GoldyTALEN Tom Ellis...pTAL7a, pTAL7b Michal Zurovec pBlue-TAL Nathan Lawson pJDS Series   Superglue proteins with SpyTag...
  37. 9 tips for a successful postdoctoral experience

    Type
    Blog Post
    ...is. If the person makes time for you, as needed, this is a strong indicator that this person cares about...limited job opportunities in academia - the main reason most people enter postdoctoral training. Similarly... the postdoctoral mentor, and at least one more person that knows you and your research well. Who could...and skilled speaker. There's a more fundamental reason to give presentations - networking! People get ...unpublished information and reagents. Part of the reason I got my first faculty position was because the...institute about me, even though I had not asked this person to write a letter of reference. The group leader...not take time off when you are a PF. Here is my personal list:   Exercise - nothing dissipates stress ...
  38. Engaging with science and society at pgEd

    Type
    Blog Post
    ...Johnny Kung, Director of New Initiatives for the Personal Genetics Education Project (pgEd). Advances in...exacerbating existing inequalities and injustices. The Personal Genetics Education Project (pgEd), where I currently...conversations about both the benefits as well as the personal, social and ethical implications of genetics. ...cultural or religious affiliation, and ethnic or personal identity. We do this through a variety of activities...activities, including creating educational materials and lesson plans that are made freely available online; running...translating all these into social media and blog posts, lesson plans, or information briefs for policymakers. ...Kung is the Director of New Initiatives for the Personal Genetics Education Project (pgEd). He is broadly...
  39. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...labelled with horseradish peroxidase (HRP; Kristensson and Olsson, 1971), plant lectins (wheat germ agglutinin...24336151. PubMed Central PMCID: PMC4004172. Kristensson, K., and Olsson, Y. (1971). Retrograde axonal transport...difficult to accurately map network connections (Lo & Anderson, 2011). In the past two decades, several virus...PubMed Central PMCID: PMC4324159. Castle, M.J., Gershenson, Z.T., Giles, A.R., Holzbaur, E.L., and Wolfe...29, 363–365. PubMed PMID: 4107258. Lo, L., and Anderson, D.J. (2011). A Cre-dependent, anterograde transsynaptic..., J.S., Hyman, B.T., and McLean, P.J. (2009). Comparison of transduction efficiency of recombinant AAV... V., Thiry, I., Deroose, C. M., Mortelmans, L., Wilson, J.M., Debyser, Z., and Baekelandt, V. (2007). ...
  40. Plasmids 101: 5 factors to help you choose the right cloning method

    Type
    Blog Post
    ...a price of a few dollars per reaction. By comparison, Gibson assembly can cost over $15.00 per reaction...In today’s post, we will focus on a high-level comparison of popular cloning methodologies, with a special...as 30 minutes! Alternatively, you might consider Gibson cloning. In this technique, you first perform a...reaction if you purchase a pre-made mix. Nonetheless, Gibson assembly is a highly versatile and efficient way...propagating. The ligation-independent methods like Gibson and SLIC are also quite efficient; although efficiency...them are some of the homology based methods, like Gibson or SLIC, since one can pool the components and ...
  41. PhD Applications After COVID

    Type
    Blog Post
    ...students who are unable to attend in-person interviews for a variety of reasons (logistical, financial, etc…)...visit in person, things like sickness or scheduling issues can and do interfere with those in-person plans...COVID-19 and standards for hybrid, virtual, and in-person events change seemingly daily (and are inconsistent...about the program and having the time to ask personalized questions might be difficult. However, an online...Even if you had planned a campus visit and the in-person portion got canceled, taking advantage of virtual...
  42. PCR Applications for Copy Number Variation Assays

    Type
    Blog Post
    ...used to call copy numbers should be as small as reasonably possible and set using the variance seen within...negative for each reaction, math happens (this time, Poisson statistics), and the readout gives an absolute ... through concentration values, rather than by comparison to a standard curve, and most results can be ...7778-9_9. PMID: 29717442. Arya M, Shergill IS, Williamson M, Gommersall L, Arya N, Patel HR. Basic principles... S., Hollox, E. J., & Boon Peng, H. (2015). A comparison of assays for accurate copy number measurement...journal.pone.0116791 Providenti MA, O'Brien JM, Ewing RJ, Paterson ES, Smith ML. The copy-number of plasmids and ... Rachel Leeson...
  43. SciComm with the Experts at Science in the News Part 1

    Type
    Blog Post
    ... of a two-part interview with Vini Mani and Amy Gilson from Science in the News at Harvard University....your science, we sat down with Vini Mani and Amy Gilson from Science in the News, a graduate student organization...Podcast Many thanks to our guests, Vini Mani and Amy Gilson. Vini Mani is a graduate student at Harvard University...News, and member of the SITN podcast team.     Amy Gilson recently received her PhD from Harvard University...SITN podcast team. You can follow Amy on twitter @aigilson.   Special thanks to our sound engineer/producer...McFadden Learn about SITN's work at DayCon 2015 5 Reasons to Use Reddit for Science Communication ...
  44. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...changes in specificity than AAV-PHP.eB. For this reason, the Gradinaru lab anticipates that high-dose AAV-PHP.AX...happy transducing! This post was written by Rachel Leeson, with significant contributions from Cynthia Arokiaraj...Altermatt, M., Dobreva, T., Chen, S., Wang, A., Thomson, M., & Gradinaru, V. (2021). Deep Parallel Characterization...s41565-023-01419-x Deverman, B. E., Pravdo, P. L., Simpson, B. P., Kumar, S. R., Chan, K. Y., Banerjee, A....., Wang, Q., Katz, N., Buza, E. L., Bell, P., & Wilson, J. M. (2018). The Neurotropic Properties of AAV-PHP.B.... J., Bell, P., Raymond, A., Stanford, W. L., & Wilson, J. M. (2019). The GPI-Linked Protein LY6A Drives...journal.pbio.3002112 Jang, M. J., Coughlin, G. M., Jackson, C. R., Chen, X., Chuapoco, M. R., Vendemiatti,...
  45. Plasmids 101: Secondary Nanobody Toolbox

    Type
    Blog Post
    ...them for use in your lab. Structural Comparison Functional Comparison Advantages of Nanobodies How to Use...for a comparison of nanobody, HCab, and traditional IgG antibody structures. Functional comparison Strong...Nanobody Toolbox Find Nanobody Plasmids Structural comparison As the name suggests, nanobodies are smaller ...Large: Advantages of Antibodies One of the main reasons antibodies are great indirect immunodetection tools... antibody incubation. See figure 4A below for comparison of this one-step staining with nanobodies vs ...
Showing: 101 - 150 of 721 results